Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 982 results for: nin

Showing: 101 - 120 of 982 results

  1. Zebrafish Plasmid Collection

    Type
    Collection
    ...that are amenable to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox...Tools for Use in Zebrafish Looking for plasmids containing your zebrafish gene of interest? Search Addgene's...biotin labeling in zebrafish. pGCS Vector Kit - Hai-Ning Du Lab. A set of pCS2+ backbone-based Gateway destination... Amro Hamdoun Lab. A useful “starter kit” for screening fluorescent protein fusion expression in organisms...zebrafish as a model organism and to foster advanced training of young scientists in Latin America. The Zebrafish...

  2. Plasmids for Stem Cell Research

    Type
    Collection
    ...unique potential to continuously divide while maintaining an undifferentiated state. Stem cells are classified...Sox2, Klf4, and c-Myc from four separate plasmids Defining molecular cornerstones during fibroblast to iPS...Neurons Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into...human fibroblasts using self-regulating and nonintegrating viral vectors. Stem Cell Reports. 2014 Nov ...

  3. mTOR Pathway

    Type
    Collection
    ... Tackling Cancers’ Drug Resistance with a New Screening Kit Background mTOR Pathway Plasmids mTOR Gene... growth and proliferation. mTOR, a serine/threonine kinase, is found in two complexes, mTORC1...LST8 homolog LKB1 Also known as STK11; serine/threonine kinase 11 mTOR Mechanistic target of rapamycin... Tackling Cancers’ Drug Resistance with a New Screening Kit (from David Sabatini & Kris Wood) References...

  4. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...mutant to inhibit MMR PEmax - optimized PE2 enzyme containing RT optimized for human codons, additional nuclear...check out our prime editing blog post . Need help designing a pegRNA? Try the DeepPrime (Link opens in a new...of gRNA (e.g., pegRNA, epegRNA, nicking sgRNA), cloning enzyme, selectable marker, and whether the plasmid...Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9 Selection PI 132777 pU6...

  5. Distribution to Industry

    Type
    Collection
    ...Assembly Standards Kit Cloning Eric Cantor Kit for using comprehensive end-joining ligation fidelity and...Expression Sylvestre Marillonnet 95 plasmids for cloning and assembling standardized parts to create eukaryotic...exon 5–8. Phagemid Synuclein VHH Immune Library Screening Messer and MJFF Created for research in Parkinson's...

  6. Worm Expression Resources

    Type
    Collection
    ...sets of plasmids intended for use together (e.g. cloning and expression systems) and therefore supplied ...editing in C. elegans via a CRISPR-Cas9 system. Cloning-free CRISPR for C. elegans , which uses purified...spatial control of gene expression in C. elegans by combining expression of the FLP recombinase from either ...with accurate, current, accessible information concerning the genetics, genomics and biology of C. elegans...

  7. Lentivirus Plasmids

    Type
    Collection
    ....1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy cloning Root 14748...shRNA. See article for detailed information about cloning & additional plasmids. Aebischer and Trono 11795... the gene of interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in...

  8. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Gong L, He M, Zhou P, Paninski L, Li B. 2017. The central amygdala controls learning in the lateral amygdala... N. 2019. Excitation of diverse classes of cholecystokinin interneurons in the basal amygdala facilitates...McElligott ZA, Holmes A, Heisler LK, Kash TL. 2016. Serotonin engages an anxiety and fear-promoting circuit ...

  9. Resolute Plasmid Collection

    Type
    Collection
    .... These vectors allow a fast and efficient sub-cloning into a wide range of Gateway-compatible pDEST vectors...pooled libraries are useful tools for genetic screening experiments. These libraries target the solute...NeuroMab Plasmid Collection Addgene Blog: Gateway Cloning Content last reviewed: 12 August 2025...

  10. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...based on the pDRF1 plasmid (Loqué et al., 2007) containing the PMA1 promoter and the URA3 marker, the p415...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid...

  11. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...suffix sequences are given for the coding strand , meaning that the suffix will need to be reverse complimented...should be avoided whenever possible. Other popular cloning strategies for the assembly of synthetic parts ...systems such as MoClo . Check out our Molecular Cloning Techniques Guide for an overview of the most common...

  12. Antibody Production

    Type
    Collection
    ...concentration is confirmed by Coomassie staining. For Coomassie staining, the sample is separated via a denaturing...formulation buffer is phosphate-buffered saline containing 1 mM sodium azide. This buffer is not compatible...

  13. Viral Vector Guides and Plasmids

    Type
    Collection
    ...multi-plasmid systems. These systems consist of a plasmid containing the genetic information to be delivered (transfer... or shuttle plasmid) and one or more plasmids containing the necessary components of the viral genome ...Many viral plasmids are also self-inactivating, meaning that they can only complete one round of transcription...

  14. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP-39...stress granules 114411 TNNI1-mEGFP AICSDP-34 mEGFP Troponin I, slow skeletal type Sarcomeric thin filaments...Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP...

  15. Validated gRNA Sequences

    Type
    Collection
    ...Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA...TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N... N. meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus...

  16. p53 Pathway

    Type
    Collection
    ...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...PIRH-2 Ring finger and CHY zinc finger domain containing 1 (RCHY1); E3 ubiquitin protein ligase PTEN Phosphatase...

  17. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...suited to simplify the cloning process as it can be used in blue–white screening . Adenoviral Vector ID...promoter. WPRE has been removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express...

  18. Open Enzyme Collection

    Type
    Collection
    ...Jennifer Molloy Lab Plasmids Blog: Golden Gate Cloning (Link opens in a new window) The Open Enzyme Collection...collection include polymerase chain reaction (PCR), cloning, isothermal amplification, reverse transcription...the basis of manufacturing their own enzymes by cloning them into an expression vector of their choice ...

  19. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...plasmid and is not compatible with other plasmids containing high copy ColE1/PUC-like origins. Therefore, ...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also...

  20. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...mediate the integration of a large DNA payload containing an attB target site into a genomic attP site....the expression of one gene while simultaneously turning on another. The FLEx switch system takes advantage... target location for integration of a plasmid containing a gene of interest and another FRT site. Flp ...
Showing: 101 - 120 of 982 results