...with a wide variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance...preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism which frequently causes insertions... based on factors such as selectable marker or cloning method. When using CRISPR, you will need to express... same cell at the same time. Single plasmids containing both the gRNA and Cas protein act as all-in-one...

...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... two types of antigen specificity: monoclonal, meaning many copies of one clone that are specific to a... a certain epitope, or polyclonal, meaning there are many clones that are specific to multiple epitopes...using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific binding of antibodies...panels used currently are in the mid-forties. When designing a multiplex assay, selection of the fluorophores... your target epitope in the assay type you are running. Sufficient validation data specific to your antibody...Validation of an antibody is a process separate from running appropriate controls in your assay. There are five...

...that are amenable to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox...Tools for Use in Zebrafish Looking for plasmids containing your zebrafish gene of interest? Search Addgene's...biotin labeling in zebrafish. pGCS Vector Kit - Hai-Ning Du Lab. A set of pCS2+ backbone-based Gateway destination... Amro Hamdoun Lab. A useful “starter kit” for screening fluorescent protein fusion expression in organisms...zebrafish as a model organism and to foster advanced training of young scientists in Latin America. The Zebrafish...

...Assembly Standards Kit Cloning Eric Cantor Kit for using comprehensive end-joining ligation fidelity and...Expression Sylvestre Marillonnet 95 plasmids for cloning and assembling standardized parts to create eukaryotic...exon 5–8. Phagemid Synuclein VHH Immune Library Screening Messer and MJFF Created for research in Parkinson's...

...unique potential to continuously divide while maintaining an undifferentiated state. Stem cells are classified...Sox2, Klf4, and c-Myc from four separate plasmids Defining molecular cornerstones during fibroblast to iPS...Neurons Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into...human fibroblasts using self-regulating and nonintegrating viral vectors. Stem Cell Reports. 2014 Nov ...

... Tackling Cancers’ Drug Resistance with a New Screening Kit Background mTOR Pathway Plasmids mTOR Gene... growth and proliferation. mTOR, a serine/threonine kinase, is found in two complexes, mTORC1...LST8 homolog LKB1 Also known as STK11; serine/threonine kinase 11 mTOR Mechanistic target of rapamycin... Tackling Cancers’ Drug Resistance with a New Screening Kit (from David Sabatini & Kris Wood) References...

...mutant to inhibit MMR PEmax - optimized PE2 enzyme containing RT optimized for human codons, additional nuclear...check out our prime editing blog post . Need help designing a pegRNA? Try the DeepPrime (Link opens in a new...of gRNA (e.g., pegRNA, epegRNA, nicking sgRNA), cloning enzyme, selectable marker, and whether the plasmid...Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9 Selection PI 132777 pU6...

...sets of plasmids intended for use together (e.g. cloning and expression systems) and therefore supplied ...editing in C. elegans via a CRISPR-Cas9 system. Cloning-free CRISPR for C. elegans , which uses purified...spatial control of gene expression in C. elegans by combining expression of the FLP recombinase from either ...with accurate, current, accessible information concerning the genetics, genomics and biology of C. elegans...

....1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy cloning Root 14748...shRNA. See article for detailed information about cloning & additional plasmids. Aebischer and Trono 11795... the gene of interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in...

...Gong L, He M, Zhou P, Paninski L, Li B. 2017. The central amygdala controls learning in the lateral amygdala... N. 2019. Excitation of diverse classes of cholecystokinin interneurons in the basal amygdala facilitates...McElligott ZA, Holmes A, Heisler LK, Kash TL. 2016. Serotonin engages an anxiety and fear-promoting circuit ...

...based on the pDRF1 plasmid (Loqué et al., 2007) containing the PMA1 promoter and the URA3 marker, the p415...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid...

...Plasmid Collection You may also like... Gateway Cloning Brain Initiative Collection NeuroMab Collection.... These vectors allow a fast and efficient sub-cloning into a wide range of Gateway-compatible pDEST vectors...pooled libraries are useful tools for genetic screening experiments. These libraries target the solute...

...suffix sequences are given for the coding strand , meaning that the suffix will need to be reverse complimented...should be avoided whenever possible. Other popular cloning strategies for the assembly of synthetic parts ...systems such as MoClo . Check out our Molecular Cloning Techniques Guide for an overview of the most common...

...concentration is confirmed by Coomassie staining. For Coomassie staining, the sample is separated via a denaturing...formulation buffer is phosphate-buffered saline containing 1 mM sodium azide. This buffer is not compatible...

...Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579 RAB5A-mEGFP AICSDP-39...stress granules 114411 TNNI1-mEGFP AICSDP-34 mEGFP Troponin I, slow skeletal type Sarcomeric thin filaments...Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP...

...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...PIRH-2 Ring finger and CHY zinc finger domain containing 1 (RCHY1); E3 ubiquitin protein ligase PTEN Phosphatase...

...suited to simplify the cloning process as it can be used in blue-white screening and forms blue colonies...promoter. WPRE has been removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express...

...Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA...TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N... N. meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus...

...choice (Fig. 1B) . Thus, through standard plasmid cloning, viruses can be engineered to harbor a wide array...easily modified and amplified (through standard cloning methods). There are different types of viruses ...your institution’s Biosafety Committee before beginning virus work. For general virus biosafety guidelines...

...collection include polymerase chain reaction (PCR), cloning, isothermal amplification, reverse transcription...the basis of manufacturing their own enzymes by cloning them into an expression vector of their choice ...Plasmids Jennifer Molloy Lab Plasmids Golden Gate cloning...