Skip to main content
Addgene
Showing: 301 - 350 of 398 results
  1. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...contains the following mutations: Y444F, Y500F, and Y730F. AAV2(4pMut)dHS The AAV2(4pMut)dHS serotype displays...21):6229-39. PMID: 26310623 AAV2(4pMut)dHS When using the AAV2(4pMut)dHS serotype in future publications...spread following injection in the brain. The AAV2(4pMut)dHS serotype was developed by Shannon Boye’s lab...It is derived from AAV2 and has the following mutations: Y444F, Y500F, Y730F, T491V, R487G, R585S, and...from the AAV6 capsid and contains the following mutations: Y705F, Y731F and T492V. AAV44.9 The AAV44.9 serotype...High-efficiency transduction of the mouse retina by tyrosine-mutant AAV serotype vectors. Mol Ther . 2009 Mar;17(3)...citations include: Bogner, et al. 2015. Capsid Mutated Adeno-Associated Virus Delivered to the Anterior...
  2. Plan Your Experiment

    Type
    Collection
    ...knockout )? Generate a specific mutant allele of a gene ( point mutant )? Increase or decrease expression...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the... type or organism without a specific preferred mutation Cas9 (or Cas9 nickase) Single (or dual) gRNA targeting... a particular gene, such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base...knockout. Base editors can make a limited set of mutations. Repress or Interfere (CRISPRi) Reduce expression... the N-terminus are targeted since frameshift mutations here increase the likelihood that a nonfunctional...of NHEJ. In HDR gene editing experiments, most mutated alleles will not contain the desired edit, as a...
  3. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...designed and screened a large library of iGluSnFR3 mutants, identifying the two  best-performing variants ...
  4. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Recombinases Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55636 pAAV-EF1a-Cre None ...-dependent Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55641 pAAV-Ef1a-fDIO EYFP...Fluorophores Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55650 pAAV-hSyn Con/Fon EYFP...recombinase-dependent: GECI Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 137119 pAAV-EF1a-Con/Fon-...Excitatory Opsins Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 55645 pAAV-hSyn Con/Fon hChR2...Inhibitory Opsins Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 137148 pAAV-nEF-Con/Fon-Arch3.3...recombinase-dependent: DREADDs Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral Items 177669 pAAV-nEF-Coff/Fon ...
  5. COVID-19 Resources

    Type
    Collection
    ...) Ectodomain and RBD mutants that can be used to identify antibody escape mutants and for comprehensive... and RBD mutants (Timothy Whitehead). SARS-CoV-2 Spike Receptor Binding Domain Deep Mutation Scanning ...Site-Saturation Mutagenesis Libraries - Libraries of variant Spike protein RBD mutations for comprehensive...Libraries : Pooled libraries of spike protein mutations. Research Articles : A list of free access articles...Scanning Library - Library of Spike protein RBD mutations for comprehensive mapping (Jesse Bloom). SARS-CoV-2...
  6. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...glyoxysomal, mitochondrial, peroxisomal) Mutation (specific mutation, "active site", "active site loop", or...-type malate dehydrogenase genes and watermelon mutant clones for your course-based undergraduate research...single protein with many available isoforms and mutants provides a shared experience for the research community...of wild-type MDH genes from several species and mutant clones from watermelon have been codon-optimized...interface") ID Plasmid Description Gene/Insert Mutations Additional Resources MDH CUREs Community (Link...
  7. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...somatic hypermutation in a 100 bp window. This technique creates diverse populations of mutants for directed... create A->G (or T->C on the opposite strand) mutations. CRISPR-X, a base-editing system from the Bassik... Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
  8. Cre-lox system

    Type
    Collection
    ...levels mutant TEF2 Yeast Piper 60931 pPL5608_TEF1*-Cre_TRP1 Cre expressed at low levels mutant TEF1 Yeast...levels mutant TEF1 Yeast Piper 60933 pPL5628_TEF1*-Cre_MET15 Cre expressed at low levels mutant TEF3 Yeast...alternative Cre recombinases that recognize specific mutant loxP sites, VloxP and SloxP sites respectively....Green 12496 p270 pCMV-CRE-M-AR(LNCaP) CREM fused to mutant AR ligand binding domain CMV Mammalian Green 12497...12497 p274 pCMV-CRE-M-AR(T) CREM fused to mutant AR ligand binding domain CMV Mammalian Green 12529 pBS...different types of target sites available, both mutant and wild type. The ability to manipulate the number...pAAV-CA-FLEX Cre activates gene of interest, using 4 mutated lox sites AAV Uchida Cre Reporters and Tools In...
  9. Cancer Research Plasmids and Resources

    Type
    Collection
    ... for use in cancer signaling studies, including mutant, knockdown, and overexpression constructs. Each...growth of the cell. p53 p53, the most frequently mutated gene in human cancer, is a transcription factor...Meyerson , and Root Labs containing wild-type and mutant alleles described in the initial Target Accelerator...vectors for in vitro and in vivo research. TP53 Mutagenesis Library : Pooled library from the Hahn and Root...labs for characterization of all possible p53 mutations. Resources New Tool for Lineage Tracing: The ClonTracer...
  10. AAV for Neuronal Tracing

    Type
    Collection
    ...pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA...AAV together can be used to complement deletion-mutant rabies virus AAV1 Wickersham 100799 pAAV-TREtight-mTagBFP2...the cell population of interest with a deletion-mutant tracing virus that lacks the ability to infect ... To enable monosynaptic spread of this deletion-mutant rabies, the essential G protein is provided to ...2007a. Retrograde neuronal tracing with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932...
  11. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ... protein component of MMR) mutant to inhibit MMR PE5 - PE3 plus MLH1 mutant to inhibit MMR PEmax - optimized...installing targeted insertions, deletions, and point mutations using a prime editing guide RNA (pegRNA). As with...tools are available: PE2 - introduction of five mutations in RT enzyme PE3 - PE2 plus additional sgRNA PE4...additional nuclear localization signals, and two mutations in Cas9 to enhance nuclease activity; can be used...
  12. Luciferase Plasmid Collection

    Type
    Collection
    ...bright mutant of Renilla luciferase (Rluc8) through an Ala-Glu-Leu linker to the circularly permuted Venus...enhancers and untranslated regions, or the effect of mutations of these regulatory elements on gene expression...Conformationally destabilized Firefly luciferase mutants : A set of three sensors that are increasingly ...Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow for increased...Renilla CMV Mammalian expression renilla luciferase mutant Rluc8, which has increased stability and light ...
  13. TALEN Plasmids and Kits

    Type
    Collection
    ...truncated at both the N and C terminus and induces mutation at rates much higher than the parental vectors...generation architecture has been shown to increase mutation induction when using TALENs. The FokI domains ...homodimeric or enhanced heterodimeric (ELD, KKR mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination... has successfully been employed for deletion mutagenesis and gene targeting in human and mouse pluripotent...suitable for the TALEN-based generation of germline mutations in Bombyx mori and Drosophila melanogaster . Zhang...
  14. Deep Dive: qPCR

    Type
    Blog Post
    ... action and application of Scorpion primers to mutation detection, Nucleic Acids Research, Volume 28, ...
  15. CRISPR Plasmids - Yeast

    Type
    Collection
    ... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
  16. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
  17. CRISPR Plasmids - Plants

    Type
    Collection
    ... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
  18. Neurodegeneration Research Collection

    Type
    Collection
    ...dominant manner, are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, ... huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins with abnormally...-onset forms, a fraction of these are due to a mutation in one of three different inherited genes: Presenilin... collection of plasmids expressing wild type or mutant ORFs, gene fragments, and gRNAs for genes linked...
  19. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...fluorescent marker. Injection into a conditional mutant mouse brain that expressed Cre recombinase only...
  20. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...precise gene editing. These edits can include mutations seen in human patients, protein tags, or loxP/...editing rates. Advances in this area include: Nickase mutant: cuts only one strand of DNA and can be used with...off-target activity due to rationally designed mutations. Researchers have expanded the CRISPR field beyond...to be used together. Researchers have engineered mutant Cas enzymes with alternative PAM sites . Cpf1 ,...
  21. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...Design Tools CRISPR Blog Posts CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
  22. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...
  23. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Izaurralde 147272 pAc5.1B-lambdaN-HA-DmeIF4Ga-4Ebind-mut-dsRNAres_Q EIF4G His, HA, V5 Ac5 Parkinson's Elisa...17798 pM-ErbB4CTF-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol 17799 pM-ErbB4CTF-PY3 mutant ERBB4 GAL4-BD ALS...delta-kinase-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol 17802 pM-ErbB4-delta-kinase-PY3 mutant ERBB4 GAL4-BD...below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent protein (FP) ...Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized gRNA Other Tags... YFP GAL1 ALS Aaron Gitler 29608 426Gal-FUS-RRM Mutant-YFP FUS YFP GAL1 ALS Aaron Gitler 29609 pcDNA 3.2...TMEM106B_Halo_C_allele TMEM106B Halo Frontotemporal dementia in GRN mutation carriers Michael Ward 178174 VAPB_Halo_C_allele...
  24. Zhang Lab CRISPR Page

    Type
    Collection
    ...loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading...KRAS , p53 and LKB1 , the top three significantly mutated genes in lung adenocarcinoma. Delivery of a single...
  25. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...construct leads to a change in signal of a circularly permuted fluorescent protein (cpFP) or Förster resonance...Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut biosensor for extracellular ATP (Constitutive ...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...pHluorin2 for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity...
  26. Validated gRNA Sequences

    Type
    Collection
    ...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere... 72628 cut S. pyogenes 26493208 Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere...
  27. Ginkgo Bioworks COVID-19 Collection

    Type
    Collection
    ...SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression (recode...making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Resources Read Addgene's...
Showing: 301 - 350 of 398 results