Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 941 results for: Ina

Showing: 141 - 160 of 941 results

  1. Optogenetics AAV Preps

    Type
    Collection
    ...CAG ChR2/H134R EYFP Cre dependent PHPeB Viviana Gradinaru 107708 pAAV-hSynapsin- soCoChR-GFP Syn CoChR (...

  2. Adenovirus Guide

    Type
    Guide
    ...carryover from the HV in final viral preparations. Several methods to avoid HV contamination have been developed...in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then... other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized...vectors for recombinant adenoviral vector production that do not contain GFP. Recombinant adenoviral vector...heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs). Adenoviral genes are divided into...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...information about AAVs, read our AAV guide . Recombinant Adenoviral Vectors Wild-type adenoviruses have...

  3. CRISPR Guide

    Type
    Guide
    ... catalyze cytidine deamination instead of (or in addition to) adenosine deamination, producing cytosine...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...interesting adaptive immune response that detects and eliminates foreign DNA, which scientists have modified for...Overview of the basic CRISPR mechanism. CRISPR was originally employed to knock out target genes in various...SpCas9, has one active nuclease domain and one inactivated one, allowing it to generate DNA nicks by cutting...cutting only one strand. Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease...backbone HypaCas9 — increase Cas9 proofreading and discrimination evoCas9 — decrease off-target effects xCas9...

  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Guide . Recombinant AAV Vectors Wild-type AAVs have been modified by researchers to create recombinant adeno-associated...diversity of diseases such as inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and...frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes four non-structural...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...in order to deliver genetic cargo into cells. Recombinant AAV constructs are designed by replacing the ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination deficient bacterial strains, such as NEB Stable...

  5. Molecular Biology Reference

    Type
    Guide
    ...field of recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA...Origins of Molecular Genetics The Genetic Code Recombinant DNA Working with Plasmids Plasmid Elements Types...chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology, that...nucleotides, termed a codon. There are 64 codon combinations and only 20 natural amino acids, so multiple...encode for synthetic amino acids. Plasmids and Recombinant DNA Technology Chemistry techniques enable the...isolate one specific DNA sequence. The field of recombinant DNA technology has overcome this obstacle by ... reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA...

  6. Molecular Cloning Techniques

    Type
    Guide
    ...BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based cloning method. ...Then you can use bacterial recombination to easily move it into any destination plasmid that fits your experimental...Resources Molecular cloning, or the creation of recombinant DNA, is an essential process used in scientific... popular cloning methods for the creation of recombinant DNA. Restriction Enzyme Cloning Restriction enzyme...one plasmid into another is done via a single recombination reaction, drastically simplifying the process...plasmid must already be surrounded by specific recombination sites — similar to restriction enzyme cloning...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...

  7. Modular Cloning Guide

    Type
    Guide
    .... lipolytica . EXPRESSYALI Yeast Expression Irina Borodina Plasmids for assembly of single and multi-gene...tags, 6 CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use...method for creating many plasmids from different combinations of a common set of components (Weber et al.,...basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked by fusion sites into individual... signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules... only by the ability of E. coli to maintain the final plasmid after transformation. Figure 1: Overview...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...

  8. Lentiviral Vector Guide

    Type
    Guide
    ...regulatory genes, accessory genes, and the long-terminal repeats (LTRs) necessary for integration. Not ... a heterologous promoter (often CMV or RSV), eliminating the need for transactivation by Tat. Most third-generation...contain a deletion in the 3’ LTR to make them self-inactivating (SIN). This deletion is transferred to the 5...incompetent by using four plasmids instead of three and eliminates the requirement for Tat. Always includes deletion...deletion in the 3' LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable...

  9. Sequencing Primers

    Type
    Guide
    ...TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator Reverse Other Common Sequencing...' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse...TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator Reverse Tac promoter GAGCGGATAACAATTTCACACAGG...information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular Biology...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...GCAAATGGCATTCTGACATCC For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit...

  10. Antibody Guide

    Type
    Guide
    ...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...

  11. Optogenetics Guide

    Type
    Guide
    ... BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...delay the closing of the channel 470(activ.), 590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...short or long periods of neuronal activation/inactivation periods. These can range from msec (hChR2) to...expression of the opsin and the area that is being illuminated. There are several different ways to control ...especially powerful when combined with site specific recombinase technology like Cre-lox, which allows you to ...one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1,...

  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes and the long-terminal repeats (LTRs) necessary for integration. Wildtype...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable... strains reduce the frequency of homologous recombination of unstable regions, like the LTRs found in ...engineered to stably express gag-pol and/or env , eliminating the need to deliver these genes on separate plasmids...envelope and packaging plasmids. Unless multiple recombination events occur between the packaging, envelope...that have been deposited with Addgene are self-inactivating (SIN). These plasmids have a deletion in the...

  13. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...in mammalian cells. sin 3’LTR 3’ Self-inactivating long terminal repeat. f1 ori f1 bacterial origin of... Map of pLKO.1 containing an shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer ...the transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R...bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response element. A.3 Related ...repeats, especially repeated Ts because polyT is a termination signal for RNA polymerase III. Note that these...and ligated into the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest. C.1...buffer 1 1 μL AgeI add ddH 2 O to bring to 50 μL final volume Incubate at 37°C for 2 hours. Purify with...

  14. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...protocol is composed of steps that separate out contaminants from an impure AAV preparation. The 15% iodixanol...macromolecules. The 40% and 25% steps are used to remove contaminants with lower densities, including empty capsids...mg of MgCl 2 and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing through a... of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing through a....5 mL to 1 mL fractions per tube. Avoid the proteinaceous material near the 40–25% interface. Pro-Tip ...per tube, taking care to avoid collecting the proteinaceous material at the 40–25% interface. Repeat for.... Image adapted from Zolotukhin, S., et al. "Recombinant adeno-associated virus purification using novel...

  15. Lentivirus ddPCR Titration

    Type
    Protocol
    ...mL pipette 5–10 times. The final volume in the well is 1.5 mL, and the final Polybrene concentration is...high glucose, pyruvate, Corning, 10-013-CV Heat-inactivated FBS L-alanyl-L-glutamine (or alternative stable...500 mL DMEM, high glucose, pyruvate 55 mL heat inactivated premium grade, fetal bovine serum 5 mL glutaGRO...new aspirating pipette for each well as to not contaminate cell conditions with others. Gently add 1.5 mL...master mix for 9 samples. Component Volume 9X Volume Final Concentrations 2X ddPCR Supermix for Probes, no ...from the appropriate dilutions to calculate the final infectious titer. Tips and Troubleshooting We recommend...freezer blocks during use. To reduce the risk of contaminating reagents we recommend making small aliquots ...

  16. Promoters

    Type
    Guide
    ...transcription factors bind. Distal Promoter The final portion of the promoter region is called the distal...Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter...Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content...

  17. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...When to Use Them Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Antibody Guide... software Reagents Purified antigen Purified recombinant antibody Isotype control antibody HRP-conjugated...10 twice for a total of three washes. After the final wash, aspirate the wash buffer from the wells. Prepare...20 twice for a total of three washes. After the final wash, aspirate the wash buffer from the wells. Prepare...32 twice for a total of three washes. After the final wash, aspirate the wash buffer from the wells. Dilute...42 twice for a total of three washes. After the final wash, aspirate the wash buffer from the wells. Immediately...to factor in that dilution when calculating the original sample concentration!). Sample Data Figure 1: ...

  18. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...method for decontaminating must be used for proper disposal. Liquid BSL-2 waste can be decontaminated in a ...biohazardous waste. Dispose of waste that may be contaminated with pathogens or chemicals that present a danger...biohazard containers. Biohazardous materials are decontaminated prior to disposal, commonly done with an autoclave...underneath a hood. Clean any spills immediately, and decontaminate as necessary. For large spills that cannot be...participating in BSL-2 work receives a hepatitis B vaccination or titer prior to starting work in the laboratory...a final concentration of 10% bleach for 30 minutes before pouring down the drain. Solid BSL-2 waste can...

  19. CRISPR Library Amplification

    Type
    Protocol
    ...Bottlenecks, fitness differences, and plasmid recombination can all impact the representation of individual...libraries may require modifications dictated by the originating laboratory for optimal results. If you obtained...replication and antibiotic selection). This recombination, at a low rate, is not typically a problem as...lentiviral particles. See below for options if the recombinant band makes up a significant proportion of the...electrocompetent cells that are suitable for unstable or recombination-prone DNA. The use of electrocompetent cells...step. I got a heavy recombined band by digest. Recombination is thought to be in part related to selective...burden on the bacteria. Bacteria that contain a recombinant plasmid likely grow faster in the closed system...

  20. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...FBS can be purchased already heat-inactivated, or it can be inactivated in the lab by heating to 56 °C for...transiently-transfected cells, increases reproducibility, as it eliminates the variation associated with repeated transient...antibiotic selection on transduced cells enables elimination of untransduced cells, resulting in a more homogenous...glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene (10 mg/mL), Millipore TR-1003-G...bottle of DMEM high glucose, add 55 mL of heat-inactivated FBS and 5mL of 100X glutaGRO. Store at 4 °C. ...made with DMEM complete + 10 µg/mL polybrene, the final concentration of polybrene in each well should be...
Showing: 141 - 160 of 941 results