Skip to main content

We narrowed to 153 results for: N-pac

Showing: 141 - 153 of 153 results
  1. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...The pCoofy series of plasmids contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep...types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of interest...optimal scaffold can depend on the length of the spacer region between the target sequences. These updates...
  2. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...drop-down menu to indicate whether the tag is on the N or C terminus and whether it was present in the backbone...with a unique Deposit ID. Addgene will send you a package containing instructions on how to prepare your ...
  3. Plasmids for Stem Cell Research

    Type
    Collection
    ...Klf4, and c-Myc from polycistronic cassettes KLF4 N-terminal variance modulates induced reprogramming ...are proliferative, unspecialized cells with the capacity to differentiate into many different cell types...every other cell type in the body and have the capacity to give rise to an entire organism. iPSC technology...
  4. CRISPR Guide

    Type
    Guide
    ... Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan, ...34478496 Yarnall, M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L.,...Ter-Ovanesyan, D., Braff, J. L., Davidsohn, N., Housden, B. E., Perrimon, N., Weiss, R., Aach, J., Collins, J. ...Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A....Dy, A. J., Joung, J., Verdine, V., Donghia, N., Daringer, N. M., Freije, C. A., Myhrvold, C., Bhattacharyya...Yachie, N., . . . Nureki, O. (2018). Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science...1964. PMID: 29891532 Gaudelli, N. M., Komor, A. C., Rees, H. A., Packer, M. S., Badran, A. H., Bryson,...
  5. Genetic Code Expansion

    Type
    Collection
    ...Hang 126035 pEVOL-ABK PylRS M. barkeri 3’-azibutyl-N-carbamoyl-lysine (AbK) Bacterial TAG Andrea Musacchio...Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial TAG Farren... Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial TAG Farren...141173 pAcBac1-3nitroY-A7-RS A7 3nY tRNA synthetase M. barkeri Mammalian Ryan Mehl 141174 pAcBac1-haloTyrRS...acid Bacerial, Mammalian TAG Peter Schultz 50831 pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli... amino acids Mammalian TAG Peter Schultz 50832 pAcBac1.tR4-MbPyl PylRS M. barkeri variety of unnatural...barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl 174081 pAcBac1-NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84...
  6. Sequencing Primers

    Type
    Guide
    ...CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse hU6-...AGCTGGACATCACCTCCCACAACG 3' end of DsRed1 Forward DsRed1-N GTACTGGAACTGGGGGGACAG 5' end of DsRed1 Reverse EBV...CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse EXFP-R...GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding... virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD...Forward CGCAACGATCTGGTAAACAC OpIE2 promoter Forward pACYC-F TGAAGTCAGCCCCATACGAT p15A origin Forward pAd-CMV...vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD...
  7. Lentiviral Vector Guide

    Type
    Guide
    ..., Y., Fuksenko, T., Pelayo, A., Shah, N. N., Kochenderfer, J. N., Norberg, S. M., Hinrichs, C., Highfill....110276 PMID: 32502836 Johnson, N. M., Alvarado, A. F., Moffatt, T. N., Edavettal, J. M., Swaminathan,.../hum.2012.229 PMID: 23311447 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen...flanked by LTRs; 8–10 kb packaging capacity Packaging plasmid — contains packaging genes gag and pol , and...tat gene Can be packaged by both second- and third-generation packaging systems Packaging Plasmid One plasmid...isoforms of these packaging components. Therefore, lentivirus may not be efficiently packaged by gamma-retroviral...transgene and wild-type LTRs Packaging plasmid — contains entire viral genome (packaging, regulatory, and accessory...
  8. Adenovirus Guide

    Type
    Guide
    ...in a new window) Bullard, B. L., Corder, B. N., Gordon, D. N., Pierson, T. C., & Weaver, E. A. (2020). ...Roederer, M., Goudsmit, J., Koup, R., & Sullivan, N. J. (2011). Recombinant adenovirus serotype 26 (Ad26... new window) Luo, J., Deng, Z. L., Luo, X., Tang, N., Song, W. X., Chen, J., Sharff, K. A., Luu, H. H....different plasmids or the packaging cell line, which not only frees up more space for genetic cargo but also...vectors and further increase the transgene packaging capacity up to ~10.5 kb. The deleted E2 and E4 regions...linearized with PacI to create a linear dsDNA construct flanked by ITRs. Cells from the packaging HEK293 or ...contain the viral gene E4, adding 2.7 kb of packaging space. However, these constructs must be transfected ...
  9. Plan Your Experiment

    Type
    Guide
    ...Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., Burks, T., Raychowdhury, R., Adamson... T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016). Perturb-Seq: Dissecting Molecular...Zukher, I., Dujardin, G., Sousa-Luís, R., & Proudfoot, N. J. (2023). Elongation roadblocks mediated by dCas9...vectors is that the packaging limit (how large of a DNA sequence you can actually package into your viral ...Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system...efficiencies. The template sequences can also have a large impact on editing efficiency. So while testing multiple...promoters, and selection markers. There are also no packaging limits as there are for viral vectors — the only...
  10. Optogenetics Guide

    Type
    Guide
    ...Acker, L. C., Sørensen, A. T., Young, A., Klapoetke, N. C., Henninger, M. A., Kodandaramaiah, S. B., Ogawa...10.1371/journal.pone.0000299 PMID: 17375185 Klapoetke, N. C., Murata, Y., Kim, S. S., Pulver, S. R., Birdsey-Benson...Description Peak Response Spectra (nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa ...
  11. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (2004). Recombinant AAV viral vectors pseudotyped...Y., Jang, M. J., Yoo, B. B., Greenbaum, A., Ravi, N., Wu, W. L., Sánchez-Guardado, L., Lois, C., Mazmanian...cell DNA synthesis but further limits the packaging capacity of rAAV vectors to ~2.4 kb. Figure 4: Examples... capsid is challenging due to its limited packaging capacity, especially if any additional regulatory ... more information. Split AAVs to increase packaging capacity Another strategy to deliver cargo too large...and References Addgene's Viral Vector Packaging Services Packaged-on-Request AAV Preps In-Stock AAV Preps...& Engelhardt, J. F. (2001). Expanding AAV packaging capacity with trans-splicing or overlapping vectors...
  12. Modular Cloning Guide

    Type
    Guide
    ...including destination vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular...Naomi Nakayama A toolkit with both high cloning capacity and vector simplicity, compatible with other MoClo...between 12 and 31 repeats. Golden Gate TALEN Accessory Pack Genome Engineering, TALEN Takashi Yamamoto Nine ...
  13. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... NIH Bookshelf De Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds...flanked by LTRs; ~8 kb packaging capacity Packaging plasmid — contains packaging genes gag and pol Envelope...of these packaging components. Therefore, gamma-retroviruses may not be efficiently packaged by lentiviral...to lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer... . Production Using Packaging Cell Lines Gamma-retroviral vectors can be packaged using helper-free cell...envelope and packaging plasmids. Unless multiple recombination events occur between the packaging, envelope...simpler genomes, containing only the necessary packaging genes, while lentiviruses also contain accessory...
Showing: 141 - 153 of 153 results