Skip to main content

We narrowed to 1,051 results for: sta

Showing: 141 - 160 of 1051 results
  1. Caltech Systemic Capsids

    Type
    Collection
    ... (Link opens in a new window) . As part of our standard viral production , these viral vectors undergo...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...of a transgene. Stable Cell Lines Gamma-retroviral vectors are often used to make stable cell lines. Like...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...and replicate. This feature can be harnessed for stable delivery of various genes, mutations, or treatments... in a variety of cell types and models, such as stable long-term expression in a host and low immunogenicity...specific to each virus type. From an experimental standpoint, the main difference between lentiviruses and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...
  3. Molecular Biology Reference

    Type
    Guide
    ...efficiently in a laboratory setting. Are stable — Plasmids are stable long-term, either as purified DNA or...antibiotic resistance and additional antibiotics, see our blog post on antibiotic resistance genes . Below... GUA, GUG Start AUG* Stop UAG (amber), UGA (opal), UAA (ochre) *AUG is the most common start codon. Alternative...specific genes for study and have led to the understanding of many important molecular pathways and diseases...of recombinant DNA technology has overcome this obstacle by enabling the preparation of more manageable...provide a benefit to the host, such as antibiotic resistance, and can be passed from one bacterium to another...applications — Although plasmids were originally used to understand protein coding gene function, they are now used...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...and clinical tools. Stable Cell Lines Lentiviral vectors can be used to make stable cell lines due to their...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...and replicate. This feature can be harnessed for stable delivery of various genes, mutations, or treatments...Lentiviral vectors can target non-dividing cells, enable stable long-term expression in a host, and exhibit low...contain packaging genes. From an experimental standpoint, the main difference between lentiviruses and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...
  5. Antibody Guide

    Type
    Guide
    ... the constant region, and is shown in dark blue and dark orange. The constant region is a stable part ...antibody’s constant region - specifically, it is determined by a region called the “heavy chain constant region...techniques use a nuclear stain, such as DAPI, to identify individual cells. These stains also emit fluorescent...sequencing, and enables the variable region and constant regions of the antibody to be independently manipulated...Structure Figure 1: Structure of an antibody A standard antibody is made up of four protein chains: two...responsible for producing antibodies, can change the constant region, and therefore change the isotype of antibodies...capable of recognizing and binding epitopes on constant regions of other antibodies. This has useful research...
  6. CRISPR Guide

    Type
    Guide
    ...used to install the LSR Bxb1’s landing site into the genome at a desired locus, then Bxb1 installs the donor...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...genome-wide screens. This guide will provide a basic understanding of CRISPR biology, introduce the various applications...applications of CRISPR, and help you get started using CRISPR in your own research. CRISPR Basics In this...target cleavage, while mismatches toward the 5′ end distal to the PAM often permit target cleavage. Generating... Cas9 orthologs are available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter...addition of a structured motif to enhance pegRNA stability PEmax — optimized PE architecture; increased synergy...
  7. Promoters

    Type
    Guide
    ...factors bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which...located within promoter regions, and they provide a stable binding site for the RNA polymerase and transcription...upstream) and -35 positions from the transcription start site (TSS) (Figure 2). The Pribnow box (TATAAT) ...structure of a bacterial promoter. TSS = transcription start site. Created with BioRender.com. Operons Although..., several kilobases away from the transcription start site (TSS). Eukaryotic promoters are so complex ...itself, which helps to explain how many physically distant DNA sequences can affect transcription of a given...the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure 4: Basic eukaryotic...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...overcome this obstacle, has been to use smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus ....into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...AAVs cannot enter the lytic cycle, and instead establish latent infections by integrating into the host...years without damaging the host cell. Episomal stability allows for long-term transgene expression in non-dividing...well characterized and are often preferred over standard rAAV vectors for in vivo applications. Other Engineered...
  9. Plan Your Experiment

    Type
    Guide
    ...Once you have a clear understanding of your experimental goal, you are ready to start designing the specific...This page provides a general framework to get you started using CRISPR in your research and setting up CRISPR...aware that there could be downstream translation start sites that could allow for expression of a truncated...elongation. CRISPR Activation : Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional...to be within a given range of the transcription start site in order to function effectively. Select gRNAs...into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However, the exact...experiment) and the expression time (transient or stable). For plasmid and viral-based approaches, the species...
  10. Modular Cloning Guide

    Type
    Guide
    ...GoldenBraid, and PhytoBricks standards. CyanoGate Kit Bacterial Expression Alistair McCormick Kit containing... of 4 bp. If each DNA module is flanked with a standard overhang sequence at the restriction cut site,...number of libraries containing pre-constructed standardized modules. In the first assembly step, compatible...Marillonnet 95 plasmids for cloning and assembling standardized parts to create eukaryotic multigene constructs... Parts Kit Plant Expression Nicola Patron 95 standardized parts specific for plant synthetic biology. ...plants. MoClo-YTK Yeast Expression John Dueber 96 standardized and characterized parts that can be used for...lipolytica Golden Gate tool kit Yeast Expression Tristan Rossignol 64 plasmids to assemble and integrate...
  11. Adenovirus Guide

    Type
    Guide
    ...as NEB Stable cells. These strains reduce the frequency of homologous recombination of unstable regions...transcripts are expressed after DNA replication starts and primarily encode for structural proteins needed...remain the most popular choice due to their well-established methods, relative simplicity of production, and...into the transfer plasmid can be done with most standard cloning methods, including restriction enzyme,...Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning...adenoviral backbone plasmid. One can also co-transform standard BJ5183 with supercoiled pAdEasy and the shuttle...candidates for multiple infectious diseases and prostate cancer. Cancer Treatment Recombinant adenoviral...
  12. Optogenetics Guide

    Type
    Guide
    ...the brain and nervous system to better map and understand neuronal circuits. Optogenetic tools have also...disorder research, helping scientists to better understand Parkinson's disease, depression, drug addiction...the opsin. While LMOs can also be activated by standard optogenetics workflows (such as laser or LED illumination...photocurrents 470 SFO/SSFO Step Function Opsins and Stabilized Step Function Opsins; mutations at C128 and D156...irreversible 380 Plan Your Optogenetics Experiment Before starting, check the Methods section of the original report...milliseconds with hChR2 to seconds or minutes with stable step-function opsins (SSFOs). Delivery Two factors...opsin expression. Generally, the most robust and stable expression is achieved in a transgenic mouse line...
  13. Sequencing Primers

    Type
    Guide
    ...of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine...
  14. Guide to Using Pooled Libraries

    Type
    Guide
    ... A well-designed screen can help you begin to understand what genes are important to a certain phenotype...in vivo mutagenesis, pathway mapping, and drug resistance studies. Advantages Broad range of perturbation...in a phenotype. They are also useful for drug resistance screens and noncoding RNA studies. Each library...feel free to contact us at [email protected] for assistance. For some libraries, plasmid DNA can be delivered... mechanism for lentiviral CRISPR libraries is resistance to the nucleotide analog 6-thioguanine . Because...Addgene does not offer NGS services. If you need assistance perfroming NGS, we recommend reaching out to ...
  15. Plasmids 101: Gram Negative and Positive Bacteria

    Type
    Blog Post
    ...chemistry behind Gram’s crystal violet stain and the ion interactions that cause the stain retention in gram...positive bacteria trap the crystal violet stain within their membrane, while the stain is washed from the gram...realized that certain stains were retained only in some species of bacteria. The stain colored one type, ...Gram’s discovery, adding a second stain, safranin, as a counterstain to help visualize the bleached bacteria...Procedure The stain is a pretty simple process. First, flood the heat-fixed smear with the crystal violet stain... bacteria will be stained blue or purple, and gram negative bacteria will be stained red or pink, as shown...mixing the stains and solutions used, check out these resources.   Bruckner, M. Gram Staining. https://...
  16. CRISPR Antimicrobials

    Type
    Blog Post
    ...without a resistance gene, allowing resistant bacteria to multiply, spreading their resistance genes throughout...antibiotic resistance is upon us, and the world is unprepared. Each year in the United States, two million...antibiotic resistant bacteria. Even when researchers develop new antibiotics, the onset of resistance is swift...antibiotic resistant bacteria with a weapon that they’ll have less potential to become resistant to? CRISPR...or antibiotic resistant bacteria, and inappropriate antibiotic usage selects for resistant bacteria, allowing...propagate their resistance genes. Our society is hoping to combat antibiotic resistance using multiple ...development of resistance will be slow. CRISPR may be just the method needed to jumpstart the fight against...
  17. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...Direct staining is quicker than indirect staining and eliminates potential non-specific staining that may...its native state.  Antibodies-based flow cytometry can use both direct and indirect staining methods. In...intracellular staining where binding of large immune complexes may be hindered. Indirect staining can be beneficial...fixation. If staining both cell surface and intracellular proteins in parallel, then stain the surface ... non-specific staining.  If you’re using antibodies for detection, include an unstained control with cells...cells that went through the staining procedure minus the antibody. An unstained control allows you to detect...-specific staining associated with the primary antibody. When following an indirect staining protocol,...
  18. Molecular Cloning Techniques

    Type
    Guide
    ...dsDNA at a specified distance away from the recognition sequence. Cutting distal to their recognition ...This may be due to speed, cost, availability of starting materials, or just personal preference. Check ... fragments you want to assemble before you get started. Check out Addgene's website for easy-to-use MoClo...
  19. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ... electrons are elevated from a ground state to an excited state through the absorption of photons. After... elevation in this excited state, the electron returns to its ground state by emitting a photon with slightly...lengths of time, the stability of fluorescence over time is crucial. For instance, the fluorescence of...toxicity and high photostability is crucial. These properties ensure a more consistent and stable signal over...Fluorescence refers to the emission of light by a substance (fluorophore) that has absorbed light or electromagnetic...al., 2014). Other dyes may prove challenging to stain intracellular compartments in in vivo model systems...so extra care must be taken to assess if proper staining is achieved. Fluorescent ligands have more flexibility...
Showing: 141 - 160 of 1051 results