..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...-ome using a quick, affordable, and ubiquitous reporter assay. In their recent publication, Kroeze et ...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... different human cell models and identified ~4-5-fold more fitness-related genes than have been found ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...when it is difficult for a cell to synthesize or fold a protein because of its length. Mark Howarth’s ...endogenous proteins. As described in their recent Cell Reports paper, the Kanemaki lab overcame this hurdle using...

... using a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate...of interest and an inactivated fluorescent RNA reporter. If the target sequence is present in the pool...activity of Cas13a becomes activated and the RNA reporter will be cleaved resulting in activation of the...

...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...plasmids, which contain various promoters and reporters, and subsequently inserted into a Cas9-containing...-in-one CRISPR/Cas9 vector system.” Scientific Reports 4 (2014): 5400. PubMed PMID: 24954249. PubMed Central...vectors containing the U6 promoter and the gRNA scaffold are provided with the kit. Oligonucleotides specifying...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...

....1 showed the greatest fold change in RNA and DNA levels (~25-fold and ~4-fold respectively) relative ...expression from mouse to primate neocortex. Cell Reports, 34(13). https://doi.org/10.1016/j.celrep.2021.108754...relatively even distribution of target gene expression (EGFP, in the depositing manuscript) across the brain....

...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-... complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves...or co-expression of dCas9-VP64 with a modified scaffold gRNA and additional RNA-binding helper activators...activators have been developed for bacteria by using a scaffold RNA that contains the gRNA and an RNA hairpin ...

...optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium indicators...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...photoswitch. Illumination causes the photoswitch to unfold, lowering the toxin's local concentration near ...

...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-... complex through interactions between the gRNA scaffold and surface-exposed positively-charged grooves...or co-expression of dCas9-VP64 with a modified scaffold gRNA and additional RNA-binding helper activators...activators have been developed for bacteria by using a scaffold RNA that contains the gRNA and an RNA hairpin ...