We narrowed to 18 results for: SOX
-
TypeBlog Post...using RNAP-Omega-dCas9 fusions. Here’s some others. SoxS based CRISPRa In the search for a CRISPR activation... 2018). They found a transcription factor called SoxS for CRISPRa. Adding complexity, they found that ...
-
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Sarcomeric thick filaments 124606 SOX2-mEGFP AICSDP-60 mEGFP Transcription factor SOX-2 Transcription Factor 124607... -
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post...binding to DNA. However, ABEs were improved by adding SOX, and GBE editing was increased even in chromatin ...to the base editor, they added the pioneer factor SOX2, which is capable of binding to and remodeling inaccessible...et al., 2022). Specifically, they found that the SOX2 activation domain (SAD), which recruits histone ... -
15 Hot Plasmids from 2017
TypeBlog Post...By replacing wild type SOX2 with either a SOX2-VP16 (strong activator) or SOX2-HP1 (strong repressor) ... the expression of transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming...classic technique to elucidate the mechanism by which SOX2 acts to reprogram human fibroblasts into induced...These results argue that transcription activation by SOX2 leads to its reprogramming effects. Plasmids from... at Addgene and include a variety of cMYC, KLF4, SOX2 and OCT4 DNA binding domain and transcription activation... -
Donations from Addgene to Yield Answers for Rare Disease Researchers
TypeBlog Post...Wattanasirichaigoon carried different mutations in a gene called SOX10. To understand the functional role of those mutations...cell lines and/or mouse models carrying different SOX10 mutations. More specifically, they’ve proposed to...big progress in elucidating association between SOX10 and WS4 and also several other rare genetic diseases... -
pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs
TypeBlog Post...expression of the reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical...of two vectors that encoded six factors - OCT3/4, SOX2, KLF4, C-MYC, LIN28 and SV40 large T antigen (SV40LT...Episomal Plasmid Addgene ID# Encodes pCXLE-hSK 27078 SOX2 and KLF4 pCXLE-hUL 27080 L-MYC and LIN28 pCXLE-hOCT3... -
Delivery Methods for Generating iPSCs
TypeBlog Post...peptide polycistronic cassette comprised of OCT4, SOX2, LIN28, NANOG, and a GFP reporter. Minicircles are...including reporters and RNAi) for: NANOG OCT4 SOX2 MYC KLF4 LIN28 Check out these plasmids if you... -
Four Factors that Differentiate the Stem Cell Field
TypeBlog Post...differentiated cells simply by expressing four proteins Oct4, Sox2, Klf4, and cMyc (the so called OSKM factors). As... -
Starter guide to induced pluripotent stem cells (iPSCs) part 1: A renaissance in regenerative medicine
TypeBlog Post...ectopic expression of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post... Finegold, and Markus Grompe. "Clonal tracing of Sox9+ liver progenitors in mouse oval cell injury." Hepatology... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...measure of ICC assay specificity. We generally include Sox2-V5 tagging as a positive control in our knock-in... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that induce a differentiated ... -
Plasmids for Stem Cell Research
TypeCollection...pluripotent state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Article PI Lentivirus Human Expression of human Oct4, Sox2, Klf4, Myc, and Brd3R from five separate lentiviral.... Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral... Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids...lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral vector for "hit...lentiviral vector for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells ...for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming Reveal... -
Validated gRNA Sequences
TypeCollection...23918387 Chen SOX17 H. sapiens GCCCAGCCCGGCCATCACCG 59725 cut S. pyogenes 25543152 Hanna Sox17 H. sapiens...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H. sapiens...GGGCAAGTACGTCGATTCCA 50926 activate S. pyogenes 24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TTGTGTGTGTGTGTGTGTgtcagtgagcagcagcTCGCCACAGTGTTGGAGA sox1a TAL3366 & TAL3367 TATAGCATGATGATGGAAacggaccttcattcccCGGGACCCCAAACCAACA sox2 (site #1) ...TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369 TGGTGGGGTAGACTTTCGagaaaatcggtttaaaTGTATAACATGATGGAAA sox9b TAL3180... -
CRISPR Plasmids - Tagging
TypeCollection... PX458_SAP130_1 PX458_SAP130_2 SOX5 Human FLAG pFETCh_SOX5 PX458_SOX5_1 SP5 Human FLAG pFETCh_SP5 PX458... -
Tetracycline Inducible Expression
TypeCollection...-OSKM Tet-On inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch...FUW-tetO-hOKMS Tet-On inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen... -
Immunology Research Plasmids and Resources
TypeCollection...chemokine (C-X-C motif) ligand 16 CXCLG16, SR-PSOX, SRPSOX CXCL17 chemokine (C-X-C motif) ligand 17 DMC...