Skip to main content
Addgene

We narrowed to 43 results for: TYR

Showing: 1 - 20 of 43 results
  1. Genetic Code Expansion

    Type
    Collection
    ...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced...ATMY4 Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA...ATMY5 Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA...TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M. jannaschii tyrosine Bacterial TAG Jeffrey Barrick...1R26PylRS(CbzK)_AfTyrRS(p-I-Phe)_AlvtRNA-ΔNPyl(8)(CGA)_AftRNA-Tyr(A01)(CUA) 1R26PylRS and AfTyrRS CbzK and ...218771 ATMY3 Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tRNA variant...
  2. Validated gRNA Sequences

    Type
    Collection
    ...23995389 Goldstein tyr D. rerio CCCCAGAAGTCCTCCAGTCC 46761 cut S. pyogenes 23918387 Chen tyr D. rerio GGACTGGAGGACTTCTGGGG... Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S. pyogenes 24967838 Mashimo Tyr (wild...
  3. Molecular Biology Reference

    Type
    Guide
    ...Thr T ACU, ACC, ACA, ACG Tryptophan Trp W UGG Tyrosine Tyr Y UAU, UAC Valine Val V GUU, GUC, GUA, GUG Start...
  4. Bringing Sustainable Practices to the Lab: Recycling

    Type
    Blog Post
    ...Some vendors take back their expanded polystyrene (a.k.a. Styrofoam or cooler boxes). We get these boxes...receiving temperature-controlled reagents. Expanded polystyrene will likely end up in a landfill, but at least...with CO2 emissions. NEB takes back expanded polystyrene boxes for free (in the U.S.). Their cooler boxes... 1976! Millipore Sigma takes back expanded polystyrene boxes for free (in the U.S.). After you receive...
  5. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...Instead they are detected with tyramide signal amplification. Tyramide signal amplification occurs when...when HRP converts a fluorescently labeled tyramide molecule into a highly reactive radical, which is then...Detection Method Uses Pros Cons Antigens HRP (P) Tyramide signal amplification of HRP Staining cultured...Enzymatic reactions on tissues can be cumbersome Tyramide reagents can be expensive Can only stain with ...
  6. Hot Biosensors 2022: Year-End Roundup

    Type
    Blog Post
    ....013 pYtags illuminate RTK signaling Receptor tyrosine kinases (RTKs) are a major class of signaling ...the phosphorylated state of an immunoreceptor tyrosinase-based activation motif (ITAM). By fusing ITAM...enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cells. bioRxiv 2022.08.13.503850...
  7. RUBY-Red Siliques

    Type
    Blog Post
    ...mRNA using 2a sites. These convert the amino acid tyrosine to betanin, a member of a class of pigments primarily... Fig. 2: (A) Betacyanin is produced from tyrosine by the activity of 3 enzymes and a spontaneous...
  8. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...glial fibrillary associated protein (GFAP), or tyrosine-hydroxylase (TH), can limit which cells express...mediated by three partial sequences of the human tyrosine hydroxylase promoter in vivo. Molecular Therapy...
  9. Immunology Research Plasmids and Resources

    Type
    Collection
    ... 10 APO2L, Apo-2L, CD253, TL2, TRAIL TYROBP TYRO protein tyrosine kinase binding protein DAP12, KARAP,...VEGFR1 FLT3 fms-related tyrosine kinase 3 CD135, FLK2, STK1 FLT3LG fms-related tyrosine kinase 3 ligand FL ...MGC111051, SLP-65, SLP65 BTK Bruton agammaglobulinemia tyrosine kinase AGMX1, AT, ATK, BPK, IMD1, MGC126261, MGC126262..., PKC-beta, PKCB, PRKCB1, PRKCB2 PTPN6 protein tyrosine phosphatase, non-receptor type 6 HCP, HCPH, HPTP1C...homolog A (avian) MGC131774, NFKB3, p65 SYK spleen tyrosine kinase DKFZp313N1010, FLJ25043, FLJ37489 VAV1 ...VEGFD FIGNL2 fidgetin-like 2 - FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular...FL FLT4 fms-related tyrosine kinase 4 FLT41, LMPH1A, PCL, VEGFR3 FPR1 formyl peptide receptor 1 FMLP, FPR...
  10. Ras Pathway

    Type
    Collection
    ...oncogene homolog 3 ALK Anaplastic lymphoma receptor tyrosine kinase ARHGAP35 Rho GTPase activating protein ...factor 4E binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1 MAPK3 Also known as MAPK; Mitogen-activated...Fibroblast growth factor receptor FLT3 Fms related tyrosine kinase 3 FNT FNTA FNTB Farnesyltransferase, CAAX...kinase kinase MET MET proto-oncogene, receptor tyrosine kinase MLST8 MTOR associated protein, LST8 homolog...protein kinase ROS1 ROS proto-oncogene 1, receptor tyrosine kinase RPS6KA RPS6KA1 RPS6KA2 RPS6KA3 RPS6KA6 ...
  11. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...two distinct families, serine recombinases and tyrosine recombinases, based on sequence similarity and...best characterized SSR systems, Cre and Flp, are tyrosine recombinases derived from P1 E. coli bacteriophage...bacteriophage and S. cerevisiae , respectively. Other tyrosine recombinases include Dre, R, Nigri, SCre, VCre...
  12. Plasmids 101: TOPO Cloning

    Type
    Blog Post
    ...covalent bond between the cleaved 3′ DNA strand and a tyrosyl residue of topoisomerase I (1). If a 5′ hydroxyl...
Showing: 1 - 20 of 43 results