.... U6 small RNA expression shRNA From the human U6 small nuclear promoter Constitutive  Murine U6 is ... trying to pick your perfect promoter! Eukaryotic Promoters   Promoter   Primarily used for RNA     .... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...cell types or organisms, promoters must be similarly variable. Bacterial promoters only work in prokaryotic...

...sequence downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer than four gRNAs...from its own promoter. But that doesn’t mean you have to clone and transfect multiple promoter-gRNA constructs... of pX330, contains humanized wtCas9 and two U6 promoters. To use this plasmid, you simply order oligonucleotides...to three gRNAs. Entry vectors containing the U6 promoter and the gRNA scaffold are provided with the kit...cloning. gRNAs are expressed from two Drosophila U6 promoters. Cas9 must be supplied on a separate plasmid...can I express more than one gRNA from a single promoter using a plasmid like pX330? Unfortunately, the...contain Type IIS restriction sites flanking the promoter-gRNA construct, but with different sequences adjacent...

...customizable sgRNA from the U6 promoter and puromycin resistance from the EF-1a promoter. It’s a 3rd generation...the years on their own or through Addgene!) pX330-U6-Chimeric_BB-CBh-hSpCas9 - The S. pyogenes Cas9 (SpCas9...cloned to create a chimeric guide RNA. Find pX330-U6-Chimeric_BB-CBh-hSpCas9. pSpCas9(BB)-2A-Puro (PX459...

...sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to add a...the start of my target sequence? A2: The human U6 promoter prefers a 'G' at the transcription start site...

...first site accepts the sgRNA target sequence for U6 promoter expression and the second site accepts the homology...containing a direct fusion of the desired gRNA to the U6 promoter, and a second plasmid containing the homology...regions of homology to the gene of interest to promote homology directed repair after a CRISPR/Cas9 induced...

...imporant is that, upstream of the Cbh promoter, this plasmid has a U6 promoter followed by BbsI restriction sites...pyogenes (Sp) Cas9 from a Cbh promoter. Cbh is a modified version of CAG promoter that the Zhang lab has tested...

...strategy, the need for lengthy promoters, such as U6 or EF1α promoters, has limited the number of gRNAs...assembled tRNA-gRNAs is placed downstream of a lengthy promoter, which is used to drive the expression of the ...expression of itself, without using any additional promoter, which is followed by tRNA processing to release...human or plant sources) in both the strength as a promoter and the activity to release gRNAs from DAP array...-gRNA arrays, that rely on an upstream lengthy promoter to express the gRNA array, DAP arrays use tRNA...

...pC016 - LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing:...

...expression vector Promoter driving Cas9 expression can be constitutive or inducible. U6 promoter is typically...

...expresses S. pyogenes Cas9 from the PGK promoter) and U6 promoter-driven guide RNA constructs, pAdSh.U6....

...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...containing a promoter for constitutive (CMV, SV40, SFFV) or inducible (CMV-TO) cDNA expression, sgRNA (U6) expression...the available sgRNA-cargo constructs utilize a U6 promoter and contain the RNA cargo cassette inserted within...

...express hybrid Cas9-Cas12a gRNAs under a single U6 promoter. The paralog and dual-targeting hybrid gRNA library...

...Corn under promoters for transcripts uniquely transcribed by RNA Polymerase III (5S, tRNA and U6) and measuring...transcription by placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores ...

...pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter 46916 pU6-sgGAL4...pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter (negative control...retroVirus LTR promoter. The second plasmid ( pgRNA_humanized ) contains a murine U6 promoter controlled ...pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1) 46917...pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous ...pU6-sgCD71-2 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous ...contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1 promoter 46923 pSNR52-sgTET Yeast CEN...

... under control of the Drosophila U6:3 promoter Bullock 49411 pCFD4-U6:1_U6:3tandemgRNAs expression of ...expression of gRNA under control of the Drosophila U6:1 promoter Bullock 49409 pCFD2-dU6:2gRNA expression of ...of gRNA under control of the Drosophila U6:2 promoter Bullock 49410 pCFD3-dU6:3gRNA expression of gRNA ...of two gRNAs from Drosophila U6:1 and U6:3 Bullock 73914 pCFD5 multiplex gRNA plasmid Bullock 73915 pCFD6...pAct-Cas9 Expresses Cas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous genome engineering...pnos-Cas9-nos Expresses Cas9 under control of nanos promoter and 3'UTR. For germ line restricted genome engineering...dCas9 Expresses Fok1:dCas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous high specificity...

...Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2 74009 Zebrafish U6 yes, cut S. pyogenes EGFP Del Bene pUAS:Cas9T2ACre;U6:sgRNA1...sgRNA with U6 promoter 48962 Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm...of two sgRNAs from independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit ...Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen pCFD4-U6:1_U6:3tandemgRNAs Drosophila...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous... Marraffini pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) 47868 Mammalian U6 yes, cut N. meningitidis...LEU2 Lu pDestTol2CG2-U6:gRNA 63156 Zebrafish BseRI none S. pyogenes Zon pDestTol2pA2-U6:gRNA 63157 Zebrafish...

...pHAtC U6 AarI yes, cut S. pyogenes Hygro Kim pBAtC U6 AarI yes, cut S. pyogenes Basta Kim pHEE401 U6-26p...pyogenes Gao pU6-gRNA wheat U6 BbsI none S. pyogenes Gao pBlu/gRNA Arabidopsis U6 BbsI none S. pyogenes Stupar... Chen pHEE401E U6-26p BsaI yes, cut S. pyogenes Hygro Chen pHDE-35S-Cas9-mCherry-UBQ U6-26 PmeI yes, cut...opposite strand) mutations. Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...homology-directed repair (HDR). Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9...desired edits on an RT template. Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...

....org/10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription ...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...

... 35S promoter in the plant tissue. 46968 pICSL01009::AtU6p : Encodes the Arabidopsis U6 promoter in a ... used to place an sgRNA uder the Arabidopsis U6 promoter. 46966 pICH86966::AtU6p::sgRNA_PDS : Expresses...in Nicotiana benthamiana from the Arabidopsis U6 promoter. 48075 pICH86966 : A binary vector for plant ...

...Gene/Insert Promoter Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable ...Gene/Insert Promoter Selectable Marker PI Publication Drosophila Plasmid Gene/Insert Promoter Selectable...Drosophila U6:3 pegRNA BbsI No Vermilion Norbert Perrimon pCFD5-NS Drosophila Drosophila U6:3 pegRNA +...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...BbsI No Vermilion Norbert Perrimon pHSG1C3 Mammalian U6 pegRNA + nicking sgRNA BbsI for sgRNAs; BbsI + PstI...tmpknot-GG-acceptor Mammalian hU6 epegRNA BsaI No mRFP1 David Liu U6-pegRNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 +...

...Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA...are described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...tyroxine binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be...PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor)... directed repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This ...

... from the eft-3 promoter, while pMB66 and pMB67 use the hsp-16.48 heat shock promoter. All vectors include....1) promoter. 47945 pMB63 : Expresses C. elegans optimized Cas9 from the eft-3 (eef-1A.1) promoter. 47946...-16.48 promoter. 47947 pMB67 : Expresses C. elegans optimized Cas9 from the hap-16.48 promoter. Please... allows in vitro production of RNA from the T7 promoter, while pMB70 is designed for in vivo transcrition...from T7 promotor. 47943 pMB70 : Can be used to express a CRISPR guide RNA in C. elegans from U6 regulatory...regulatory sequences of an RNA polymerase III transcribed U6 snRNA. In both vectors, the target site sequence ...

...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor... 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy cloning Root 14748 pLKO.3G 3rd U6-driven...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance. ...

... the H1 promoter. 53187 pmU6-gRNA : Expresses the S. pyogenes sgRNA from the mouse U6 promoter. 53188 ...the human U6 promoter. 53189 ph7SK-gRNA : Expresses the S. pyogenes sgRNA from the 7SK promoter. 53190 pLV...activator VP64. When directed to its target in gene promoters by the sgRNA expressed in trans from pSPgRNA, ...downstream genes. Multiple sgRNAs targeted to the same promoter act synergistically to activate gene expression...

... inducible promoters as well as a gRNA expression construct using the SNR52 snoRNA promoter. A protocol...RNAs (gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves...in S. cerevisiae (budding yeast) from the TEF1 promoter 43804 p415-GalL-Cas9-CYC1t A human codon-optimized...in S. cerevisiae (budding yeast) from the GalL promoter 43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t A gRNA expression...in S. cerevisiae (budding yeast) from the SNR52 promoter Orthogonal CRISPR/Cas9 Systems: Table 3 We have...expression, human optimized 48673 M-NM-sgRNA Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG...expression, human optimized 48672 M-ST1-sgRNA Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG...

... allows in vitro production of RNA from the T7 promoter, while pMB70 is designed for in vivo transcrition...nuclease under the control of the Drosophila hsp70 promoter. 45945 pHsp70-Cas9 : The codon-optimized Cas9 ...nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy...under the control of the Drosophila snRNA:U6:96Ab promoter. 51019 pDsRed-attP : Vector for generating dsDNA...regulatory sequences of an RNA polymerase III transcribed U6 snRNA. In both vectors, the target site sequence ... 3xP3-DsRed. (Also known as pHD-DsRed-att). 51026 U6-BbsI-crRNA : Generates crRNA for use in combination...

...lower efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants...homology-directed repair (HDR). Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...desired edits on an RT template. Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...activator to your specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...Virmilion none, need Cas9 plasmid Bullock and Port pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection ...

...features and pX458 modifications: replacement of Cbh promoter with EF1alpha addition of mCherry reporter variant...reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids...shuttle plasmids to insert a second guide within a U6-guide cassette. This process is compatible with all...

...vectors express a customized guide RNA from a U6 promoter. Individual plasmids can be ordered via the links...listed below ( MLM3639 and JDS246 ) harbor a CMV promoter that drives expression of a transcript encoding...

...single transcript whose expression is driven by a U6 promoter. The two gRNAs expressed are flanked by Csy4 .... Expression of this fusion is driven by a CAG promoter. Note that the FokI-dCas9 fusion encoded by this...

...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al., ...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...

...lower efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...activator to your specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...NGG) pDD162 (Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein DR274 T7 BsaI In vitro transcription...

...the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...continuous expansion of compatible backbones, promoters, and genes available to the community. If you ...

...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2... EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7...

...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...respectively) and placed under the control of different promoters. Expression of both N and CCre in the same cell...your experiment. You can search the table for the promoter, fusion, or expression system of choice. We also...preps of Cre are available. ID Plasmid Description Promoter Expression System PI 8394 p209 pCMV-cre-K Cre-...

...pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2SM2 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2nd generation; Transgene (hPrion promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...

...sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to add a...to the start of my target sequence? The human U6 promoter prefers a 'G' at the transcription start site...of the crRNA) is also expressed from a separate promoter. In the pre-processing form, the crRNA contains...

...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1-mcherry...190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-...7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's...Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9 HTT GFP U6, EFS Huntington's Nicole Deglon 191487... Other Promoter CMV T7 polH GAL Other Clear Filters Addgene ID Plasmid Name Gene Tags Promoter Disease...78622 pX335_HR_Prnp_3 PRNP U6 Dementia Walker Jackson 78623 pX459_HR_Prnp_3 PRNP U6 Dementia Walker Jackson...MS2)_Prnp_SAM1 PRNP U6 Dementia Walker Jackson 78625 sgRNA(MS2)_Prnp_SAM2 PRNP U6 Dementia Walker Jackson...

...the 20-mer is not G. sgRNA expression from the U6 promoter of the pX330 vector is enhanced by the inclusion...each sample and sequence each colony using a U6 promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC...

...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...