Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 335 results
  1. TALENs for the EGFP Reporter Gene

    Type
    Collection
    ... TALEN plasmids targeting 48 sites in the EGFP reporter gene.... for EGFP Engineered TALENs for the EGFP Reporter Gene The Joung Lab recently used their high-throughput...engineered TALENs targeted to 48 sites in the EGFP reporter gene ( Reyon & Tsai et al., Nat Biotechnol. 2012...active at their target sites on an integrated EGFP reporter gene in cultured U2OS cells. EGFP TALEN Plasmid...
  2. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...detectable by two different tags: a reporter and an HA tag. The reporter comes in three varieties: HRP, Spaghetti...independent of the reporter. The only caveat is that HA staining is weaker than reporter staining. Picking...Picking the right reporter for your RANBody While all three reporters stain cultured cells and tissue sections...Monster, and Chicken IgY Domain RANbody Reporters. Reporter Detection Method Uses Pros Cons Antigens...genetically tagged and instead are conjugated to reporters (i.e. fluorescent dyes, HRP, etc. ) after purification... is a RANbody? A RANbody is a fusion between a reporter and a nanobody that’s encoded on a plasmid. A ...sections, some reporters are better suited for particular applications. Read on to learn more about each...
  3. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    ... CRISPR reporters in the near future.  SRIRACCHA (stable, but reversible, integrated reporter for assaying...histone)-GFP reporter into the genome of mammalian cells.  Figure 1: The SRIRACCHA reporter construct...Find GEmCherry2 reporter plasmids at Addgene Overall SRIRACHA and GEmCherry2 reporter systems provide ...Recently scientists have created CRISPR fluorescent reporter assays to quantify targeted Cas9 cleavage, and...and non-homologous end joining (NHEJ). In these reporters, editing typically results in a change in the ...this blog we will focus on two fluorescent CRISPR reporter methods, SRIRACCHA and GEMCherry2. We will cover... the Piggybac transposon to stably integrate a reporter gene that contains a puromycin resistance gene...
  4. FlipGFP, a novel fluorescence protease reporter to study apoptosis

    Type
    Blog Post
    ...fluorescent executioner caspase reporters. Several apoptosis reporters have been developed, such as the...transfer (FRET)-based executioner caspase reporters. In these reporters, the FRET pair is linked by a caspase...FlipCherry: Red fluorescence protease reporter To add to the fluorogenic reporter toolkit, the Shu Lab also designed...novel fluorogenic reporter that has a large dynamic range and high brightness. This reporter achieves approximately...fluorescence emission. FRET and fluorescence based reporters however have several limitations. First, FRET ...study apoptosis in vivo scientists need a protease reporter that has a large dynamic range and high brightness...Shu Lab from UCSF designed an improved apoptosis reporter, ZipGFP, which utilized the self-assembling split...
  5. Using Ultrasound to Image Bacteria in vivo: Acoustic Reporter Genes

    Type
    Blog Post
    ...real time, but each of these reporters has its drawbacks. Acoustic reporter genes (ARGs) overcome these...existing bacterial reporters Limited Depth of Signal/Imaging: Fluorescent reporters are not as well suited...fluorescent or bioluminescent reporters usually only detects the signal of the reporter and fail to pinpoint what...signal is coming from.   Acoustic reporter genes (ARGs) Acoustic Reporter Genes (ARGs) are engineered gene...imaging tools The luciferase reporter gene The green fluorescent protein reporter gene Resources on Addgene.org... researchers have developed in vivo bacterial reporters that use fluorophores and luciferases to track...these limitations by using gas vesicle reporters that are detectable by an inexpensive and widely available...
  6. New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression

    Type
    Blog Post
    ...What are Acoustic Reporter Genes (ARGs)? Fluorescent and bioluminescent reporter genes are widely used... to study gene expression in cells. But these reporters have limited use in vivo because they are based...expression in vivo.  But what ultrasound lacked was reporter genes that could produce ultrasound contrast. ...our lab - the Shapiro Lab - developed Acoustic Reporter Genes (ARGs), which are sets of genes that, when...5202–5209 (2017). Bourdeau, R. W. et al. Acoustic reporter genes for noninvasive imaging of microorganisms... Hurt, R. C. et al. Genomically mined acoustic reporter genes for real-time in vivo monitoring of tumors...
  7. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ... Figure 4: Reporters in Gene On include a mScarlet reporter, luciferase reporter, and neomycin resistance... editing. eGFP reporters for single base editing by APOBEC-Cas9 Though the ACE reporter quantifies APOBEC-Cas9...DSB in their previous reporter, the Harris Lab created a panel of eGFP reporters to quantify the on-target...editing reporters. Image from St. Martin et al., 2019. The Harris lab used these eGFP reporters to analyze...Transient reporter for editing enrichment (TREE) The Wang and Brafman lab developed a transient reporter for...cells segregated solely by a reporter of transfection, which only report the efficiency of plasmid delivery... functional reporter system to identify and enrich for base-editing activity The reporters mentioned above...
  8. Measuring Kinase Activity at the Single-Cell Level with Kinase Translocation Reporters (KTRs)

    Type
    Blog Post
    ...Problems with FRET kinase reporters Difficult to Multiplex: FRET reporters are comprised of two fluorescent...phosphatase-accessible. Kinase Translocation Reporters (KTRs) Kinase Translocation Reporters (KTRs) are genetically encoded...single-cell kinase activity is FRET, but FRET reporters are challenging to design and difficult to multiplex...alternative tool with their Kinase Translocation Reporters (KTRs) whose cellular localization serves as a...multiplexed together. Challenging  to Design: FRET reporter activity depends on both the distance and the .... Slower Dephosphorylation Rates: FRET-based reporters can have slower dephosphorylation rates than KTRs...KTRs which is hypothesized to be caused by FRET reporters having phosphorylated conformations that are less...
  9. Hot Plasmids - June 2019 - Optogenetics, Acoustic Reporter Genes, microRNAs, and the CRISPR-Cas9 system CHIME

    Type
    Blog Post
    ...collection of reporter plasmids is amenable to Golden Gate assembly for turning the single-input reporters into...Neuron. 2019. PubMed PMID: 30704911. Acoustic reporter genes for noninvasive imaging of microbes in mammalian...contributed by Lukas Morgan  Listen to the acoustic reporter gene podcast segment In recent years, scientists...heavily on fluorescent protein genes. These optical reporters have limited deep-tissue performance, and sometimes...Mikhail Shapiro’s lab has developed four acoustic reporter gene (ARG) plasmids to better monitor gene expression...with a resolution of less than 100 µm, the ARG reporters could be successfully visualized in vivo using...demonstrates engineered gas vesicles as the first reporter genes using ultrasound and provide a major benefit...
  10. Hot Plasmids - June 2020 - Barcoded CRISPR Library, Sparse Cell Labeling, Calcineurin Reporter, and DNA Staining Dye Alternative

    Type
    Blog Post
    ...remove a stop cassette upstream of an effector/reporter gene. In cells where the stop cassette is removed...https://doi.org/10.1101/788679 A destabilized GFP reporter for calcineurin activity in yeast Article contributed... it is an attractive drug target. Calcineurin reporters allow scientists to measure calcineurin dynamics... target calcineurin. Current calcineurin gene reporters are based on the bacterial βgal assay, and are...Büttner’s lab designed a calcineurin transcriptional reporter consisting of a quickly-degraded destabilized ...panels) equipped with destabilized GFP calcineurin reporter (blue) and stained with PI (pink) to indicate ...Image from Diessl et al., 2020. Find the GFP reporter calcineurin activity here Diessl et al., Microbial...
  11. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...vector cores. Our titers were similar to those reported by these institutions. This protocol is for a ...plasmids to find a suitable one. Some labs have reported better results when the plasmid is linearized....
  12. CRISPR Library Amplification

    Type
    Protocol
    ... Qubit. Each different DNA measurement type can report slightly different concentrations of DNA. In our...our hands fluorescent dye methods tend to report lower values than Nanodrop, although most protocols have...
  13. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins Ratiometric...imaging (Perceval) A genetically encoded fluorescent reporter of ATP:ADP ratio. Nat Methods. 2009 Feb . 6(2)...
  14. Bacterial Expression Systems

    Type
    Collection
    ...Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids Tagging and Visualization Purification...expression at a specific level. Return to Top Reporter Plasmids Reporter plasmids can be used to detect events...they activate expression of the reporter gene. Plasmid ID Promoter Reporter PI Purpose pRU Series Various...Purification Controlled Expression Reporter Plasmids You may also like… Plasmids 101 Addgene's Molecular...promoters, their associated transcription factors, and reporter genes. pCS-PesaRlux 47640 PesaR 3OC6HSL (Quorum...bacterium. Plasmids containing easily measurable reporter genes (eg. LacZ or Fluorescent Proteins ) under...transcription factor to bind to a small molecule, the reporter plasmid can be used to detect the presence of ...
  15. Luciferase Plasmids

    Type
    Collection
    ...Multiple Multi-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, ...Highlights Empty Backbones Expression Constructs Reporter Constructs Luciferase is the enzyme responsible... common choice in assays ranging from use as a reporter gene in vitro and in vivo to use in biosensors...-lives, making them useful as transcriptional reporters. However, they are not secreted, so cells must...CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle of the Firefly.... pKC-4.04, pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase...of enhancer activity using a Firefly luciferase reporter. These plasmids improve over the original STARR-seq...
  16. Church Lab CRISPR Plasmids

    Type
    Collection
    ...repression YFP reporter: protospacer B 48662 SK-YFP-ST1-B Bacterial ST1 repression YFP reporter: protospacer...repression YFP reporter: protospacer B 48664 SK-YFP-NM-A Bacterial NM repression YFP reporter: protospacer...repression YFP reporter: protospacer A 48666 SK-YFP-TD-A Bacterial TD repression YFP reporter: protospacer...48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer 48678...48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer ...48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer...
  17. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for... Lentiviral reporter vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing...pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing firefly luciferase and ZsGreen...ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter vector expressing mCherry and firefly luciferase...destabilized EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...
  18. Cre-lox system

    Type
    Collection
    ...sites AAV Uchida Cre Reporters and Tools In this subtype of loxP plasmids, reporter genes indicate which...Mammalian Pelczar 62732 Cre Reporter DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP...Vectors Cre-containing Plasmids loxP Constructs Cre Reporters & Tools Additional Resources References Background...Fluorescent Cre: The fusion of Cre to a fluorescent reporter enables visualization of Cre expression. Optimized...HRE:GFP-pGK:Cre Cre and hypoxia-responsive GFP reporter HRE Lentiviral Jacks 69570 pAAV-EF1a-N-CretrcintG...Alcudia 108639 fli1aCreERT2 Cre-ERT2; endothelial reporter fli1a Zebrafish Mercader Huber 108995 pDM1488 ...constructs Multibow uses a binary code in which reporters are initially OFF and then probabilistically ON...
  19. COVID-19 Resources

    Type
    Collection
    ...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV... also lists several luciferase and fluorescent reporter plasmids that have been used for measuring viral...on each item's material page. Actual titers are reported with each shipment. Ginkgo Bioworks Plasmid Collection...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...2020 May 14;181(4):865-876.e12. CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...
Showing: 1 - 20 of 335 results