... from solution. MBP antibodies are available for detection and/or purification of MBP-tagged proteins....Maltose binding protein Maltose binding protein (MBP) is a 45 kDa tag which can be purified (along with...with its fusion protein) with amylose resin. The MBP tag, although large, can actually increase expression...which can be isolated with glutathione resin. Like MBP, it can be removed via protease cleavage at sites...sites immediately following the tag. Unlike MBP, the GST tag can be cleaved off from the fusion protein while...fusion proteins from being purified by GST (maybe try MBP if you are having solubility issues!). Need a GST...

...interest fused to maltose binding protein (MBP, New England BioLabs). MBP has a similar function as GST in that...the fusion protein from a bacterial extract. The MBP tag can be removed using Xa protease. The carboxyl-terminus...AB3596) and mouse (NEB, E8032S) antibodies against MBP are commercially available. Factor Xa loves calcium...

...genes over time, at a range of distances from 2-75 Mbp. Labeling multiple, intrachromosomal loci Building...resolved loci with physical map distances of 2 and 75 Mbp, with the calculated fluorescent distances correlating...established physical map. In comparing pairs of targets ~2 Mbp apart, they noticed that they could evaluate the ...

...resolved loci with physical map distances of 75 and 2 Mbp, with the calculated fluorescent distances correlating...established physical map. In comparing pairs of targets ~2 Mbp apart, they noticed that they could evaluate the ...

...and stabilization, as can maltose-binding protein (MBP). Overexpression can also lead to insolubility, and... and aggregated protein is not useful protein. MBP tags can help with solubility issues, but scientists...(Bio), flanked by hexahistidine motifs (6xHis) MBP Large Protein  40 Solubility and Purification Can...

...peptide of MBP, followed by the desired nanobody (NB) sequence, an AviTAG, and 6xHis tag. The MBP signal ...

...Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1 XX Amp) Plasmid 68300 MBP-MEK1 Plasmid...Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68305 Beta lactamase S68TAG Plasmid...

...Epitope Tag(s) ID Purpose pDEST-HisMBP 11085 Tac (lactose/IPTG inducible) MBP, 6x His David Waugh Empty lactose...N-terminal 6x His tag and an MBP tag. Compatible with Gateway cloning. pDEST-periHisMBP 11086 Tac (lactose/IPTG...IPTG inducible) MBP, 6x His, signal sequence for localization to the periplasm David Waugh Empty lactose...recombinant protein with an N-terminal 6x His tag and an MBP tag. Contains a signal sequence to localize the protein...inducible, glucose repressible) His, Strep, mOCR, MBP, with and without SUMO or TEV cleavage sites to remove...(lactose/IPTG inducible) Flag, His, Strep, mOCR, MBP, GFP, with and without SUMO or TEV cleavage sites...Various combinations of N and C-terminal Strep, His, MBP, TRX, GST, SUMO, MISTIC, and LSL tags as well as ...

...enable affinity purification using a Ni-NTA resin. MBP improves protein solubility and stability. TRX and...

...Rosenbluh 98651 MBP-FUS_FL_WT FUS His, MBP T7 ALS Nicolas Fawzi 98652 MBP-FUS_FL_12E FUS His, MBP T7 ALS Nicolas...Fawzi 98653 MBP-FUS_LC_WT FUS His, MBP T7 ALS Nicolas Fawzi 98654 MBP-FUS_LC_12E FUS His, MBP T7 ALS Nicolas...98661 MBP-hnRNPA2_LC HNRNPA2B1 His, MBP T7 Multisystem proteinopathy, ALS Nicolas Fawzi 98662 MBP-hnRNPA2...atrophy Greg Matera 38005 pET-21a(+)/MBP-His-PINK1 PINK1 His, MBP T7 Parkinson's Michael J Fox Foundation...PARK7 His T7 Parkinson's Mark Wilson 61090 MBP-mmA1 HNRNPA1 MBP ALS Sean Ryder 61155 C1A-C1A-EYFP PRKCG ...Alzheimer's Thomas Wassmer 69927 pET28-MBP-TEV-AICD APP TEV, MBP T7 Alzheimer's Thomas Wassmer 70625 R777...Nicolas Fawzi 98655 MBP-FUS_FL_6E FUS His, MBP T7 ALS Nicolas Fawzi 98656 FUS_anion FUS T7 ALS Nicolas ...

...TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, Myc). These constructs include proteins like nonstructural...

... (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Wild type vs codon-optimized...

...related hybrid mice narrowed the search to a ~4.5 Mbp region of the mouse chromosome. Of the genes located...

...Plasmid ID Plasmid Name Tags 69090 pMJ915 MBP (N terminal); 6xHis (N terminal); 2xNLS (C terminal...

...AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG (Waugh lab) 3' end of ...

...), gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...

...including His, S-tag, OneStrep, CBP, Trx, GST, Halo, MBP, NusA and SUMO) for optimizing expression, solubilization...

...Human Mouse IgG2a 206531 Anti-MBP [N128A/4R] Maltose binding protein (MBP) E. coli Mouse IgG2a 206532 Anti-Keyhole...

... 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based maltose biosensor A genetically encoded, high-signal-to-noise...

...first request was on September 8, 2004 (for pcDNA-p160MBP, if you're curious.) Since then, we've distributed...