Skip to main content
Addgene

We narrowed to 7 results for: mutant p53

Showing: 1 - 7 of 7 results
  1. Addgene's Cancer Collection Pages Connect the Research Community

    Type
    Blog Post
    ...approaching the Ras problem by exploiting the different mutant versions of Ras that are most prevalent in human...fluorescent protein fusion studies and the generation of mutant cell lines. Further, for each plasmid in the kit...includes interactive maps for the Ras, mTor, and p53 pathways. The curation project continues to evolve...
  2. p53 Pathway

    Type
    Collection
    ...48kDa p53 Tumor protein p53 p53AIP1 Tumor protein p53 regulated apoptosis inducing protein 1 p53R2 p53 ...Ras pathway Background p53 Pathway Plasmids p53 Gene List References Background p53 is a transcription factor...expanding the mechanisms by which mutant p53 is known to function in cancer. p53 Pathway Plasmids Click on a...PubMed PMID: 24379683 . When mutants gain new powers: news from the mutant p53 field. Brosh R, Rotter V. ...Addgene's collection of plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor... Cancer Research p53 Pathway p53 Pathway You May Also Like: Cancer Pathway ORF... list of p53 transcriptional targets is ever-expanding; the best-characterized effects of p53 are in promoting...
  3. Cancer Research Plasmids and Resources

    Type
    Collection
    ...essential for regulating the growth of the cell. p53 p53, the most frequently mutated gene in human cancer... for use in cancer signaling studies, including mutant, knockdown, and overexpression constructs. Each...Meyerson , and Root Labs containing wild-type and mutant alleles described in the initial Target Accelerator...and Root labs for characterization of all possible p53 mutations. Resources New Tool for Lineage Tracing...expression vectors for in vitro and in vivo research. TP53 Mutagenesis Library : Pooled library from the Hahn...
  4. Luciferase Plasmid Collection

    Type
    Collection
    ...Renilla CMV Mammalian expression Renilla luciferase mutant Rluc8, which has increased stability and light ...transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. Koen Venken...luciferases : A set of three increasingly destabilized mutants which serve as sensors of proteome stress. pHLuc...
  5. Validated gRNA Sequences

    Type
    Collection
    ...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article 60224...GTCAATTGTTCTCTTTCTAT 64331 cut S. pyogenes 25281382 Jin Trp53 M. musculus CCTCGAGCTCCCTCTGAGCC 59910 cut S. pyogenes...
  6. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...with the pooled library to create a population of mutant cells that are then screened for a phenotype of...89640 Knockout Human Wei 3rd Varies 12,472 pairs HR700_TP53 Exon Mutation Libraries 229137–229140 Donor Vector...
  7. Immunology Research Plasmids and Resources

    Type
    Collection
    ...consists of 182 wild-type and 19 well-characterized mutant ORFs that represent over 25 cellular signaling ...SALPR SAA1 serum amyloid A1 MGC111216, PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond...S1P2 SAA1 serum amyloid A1 MGC111216, PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond...
Showing: 1 - 7 of 7 results