We narrowed to 7 results for: pten
-
TypeCollection...known as AKT1S1; AKT1 substrate 1 (proline rich) PTEN Phosphatase and tensin homolog Rag RRAGA RRAGB RRAGC...kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase and tensin homolog Rictor RPTOR independent...
-
Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells
TypeBlog Post...2015) Adenovirus-Mediated Somatic Genome Editing of Pten by CRISPR/Cas9 in Mouse Liver in Spite of Cas9-Specific... -
Adeno-associated Viruses (AAVs) for Genome Editing
TypeBlog Post... tags into the endogenous alleles of the p53 and PTEN tumor suppressor genes in human cells (Kim et al... -
Validated gRNA Sequences
TypeCollection...Schmitt-Ulms Pten M. musculus AGATCGTTAGCAGAAACAAA 59909 cut S. pyogenes 25119044 Jacks Pten M. musculus...GCTGTAGTAATATCTGCTAT 66588 cut S. pyogenes 26018130 Xue Pten M. musculus GTTTCATAGCGGCCACGAAGT 66587 cut S. pyogenes... -
p53 Pathway
TypeCollection...containing 1 (RCHY1); E3 ubiquitin protein ligase PTEN Phosphatase and tensin homolog PUMA BCL2 binding... -
Ras Pathway
TypeCollection...subunit beta G1, G2, G3: non-catalytic subunit gamma PTEN Phosphatase and tensin homolog RAC RAC1 RAC2 RAC3... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...synthetase Mammalian Cells pCMV-DnpK dinitrophenyl hapten Mammalian Cells pANAP AnapRS Mammalian Cells ...