Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 40 of 666 results

  1. Sonic Hedgehog? Sleeping Beauty? Learn About the Genes Behind Addgene’s Conference Room Names

    Type
    Blog Post
    ...but also a biological transposon system. Sleeping Beauty is a synthetic transposon system that can be used...resurrecting this transposon system? Scientists can use Sleeping Beauty transposons as a non-viral system...Now, we have meetings in rooms such as Groucho, Sonic Hedgehog, Sleeping Beauty, Cookie Monster, Spaghetti...Shivdasani Lab from the Dana Farber Cancer Institute! Sonic Hedgehog, an important regulator of embryonic development...The largest conference room at Addgene is named Sonic Hedgehog but this is not a direct reference to the...gene in animal development. To understand where sonic hedgehog got its name, we need to go back to 1980...Wiechaus, 1980). The mammalian hedgehog protein, sonic hedgehog (SHH) was named by a postdoc in Cliff Tabin...

  3. Running for Rare Disease, Running for FOP, Running for AJ

    Type
    Blog Post
    ...family, he did not seem much different than my second son of similar age. When he came to visit us and watch...  Many thanks to our guest blogger Kurt Swanson! Kurt Swanson is a structural biologist and protein engineer...This post was contributed by Kurt Swanson a structural biologist and protein engineer currently working...

  4. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ...Current Protocols in Protein Science. John Wiley & Sons, Inc. https://doi.org/10.1002/0471140864 Fox, J....

  6. AAV Production in HEK293 Cells

    Type
    Protocol
    ... of sonication to avoid overheating of the sample. Mix well between rounds of sonication. Sonicate until...container pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents Adherent HEK293T...completely. Combine all resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice...

  7. Immunology Research Plasmids and Resources

    Type
    Collection
    ...RaLP, SHCD SOS1 son of sevenless homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless ... RHOH12 SOS1 son of sevenless homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless ...Set : From Jesse Boehm , William Hahn , Matthew Meyerson , and David Root , this kit consists of 182 wild-type..., Hu Z, Zalocusky KA, Shankar RD, Shen-Orr SS, Thomson E, Wiser J, Butte AJ. 2018. ImmPort, toward repurposing...

  8. Before You Enter the Lab

    Type
    Protocol
    ...started working in the lab, learn the basics of personal protective equipment and lab safety.... to know. In this module, you will learn about personal protective equipment (PPE) and general laboratory...precautions for the lab. Chapter 1 Duration 5min 47sec Personal Protective Equipment (PPE) Guidelines You will...

  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's Mark Cookson 13315 ...CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13318...CMV Parkinson's Mark Cookson 13319 pLenti6-DEST PINK1-V5 KD PINK1 V5 CMV Parkinson's Mark Cookson 13320...V5 CMV Parkinson's Mark Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X...His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted Dawson 17613 pRK5...GFP CMV Parkinson's Mark Cookson 25045 pDEST53-LRRK2-G2019S LRRK2 GFP CMV Parkinson's Mark Cookson 25046...GFP CMV Parkinson's Mark Cookson 25048 pDEST53-LRRK2-Y1699C LRRK2 GFP CMV Parkinson's Mark Cookson 25049...

  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ....bGH James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV1917 105541...eGFP.WPRE.rBG James M. Wilson AV-1-PV1963 105542-AAV1 pENN.AAV.CB7.CI.eGFP.WPRE.rBG James M. Wilson AV-1-PV2177 ...pENN.AAV.CMVs.TurboRFP.WPRE.RBG James M. Wilson AV-1-PV2642 105552-AAV1 pENN.AAV.hSyn.TurboRFP.WPRE.RBG James M. Wilson AV-1-PV2975...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-2-PV1963 105542....WPRE.bGH James M. Wilson AV-5-PV0102 105531-AAV5 pAAV.CMV.LacZ.bGH James M. Wilson AV-5-PV1917 105541...eGFP.WPRE.rBG James M. Wilson AV-5-PV1963 105542-AAV5 pENN.AAV.CB7.CI.eGFP.WPRE.rBG James M. Wilson AV-5-PV2177 ....RBG James M. Wilson AV-5-PV2213 105547-AAV5 pENN.AAV.EF1a.eGFP.WPRE.rBG James M. Wilson AV-5-PV2369 105598...

  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...* Michael Davidson 54491 mCherry-Lifeact-7 Actin Filaments LifeAct mCherry* Michael Davidson 54610 mEGFP-Lifeact...Michael Davidson 55148 mCherry-Tubulin-C-18 Microtubules alpha-tubulin mCherry* Michael Davidson 12298 ...Michael Davidson 55165 mCherry-ZO1-C-14 Tight Junctions Zonula Occludens-1 mCherry Michael Davidson 55001...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5... 38770 pEF.myc.ER-E2-Crimson Endoplasmic Reticulum ER retention signal E2-Crimson Benjamin Glick 36204... James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson 12674 GFP-rab11...

  12. Chemogenetics Plasmids

    Type
    Collection
    ...Gi) CAG mCherry Yes Sternson 52525 CMV:: HA-hM4Dnrxn hM4Dnrxn (Gi) CMV No Sternson 52523 CAG:: mCherry...mCherry No Sternson 52521 AAV-CAG::FLEX-rev:: ChR2HA-2a-hM4D hM4Dnrxn (Gi) CAG ChR2-2a Yes Sternson 52520 ...ChR2 2A Yes Sternson 32482 CAG::PSAMQ79G:GlyR-IRES-GFP PSAMQ79G-GlyR CAG IRES-EGFP No Sternson 32481 rAAV-syn...IRES-EGFP Yes Sternson 32478 CAG::PSAML141F:GlyR-IRES-GFP PSAML141F-GlyR CAG IRES-EGFP Yes Sternson 32477 rAAV-syn...IRES-EGFP No Sternson 119739 pCAG PSAM4 GlyR IRES EGFP PSAM4-GlyR CAG IRES-EGFP No Sternson 119740 pCAG...IRES-EGFP No Sternson 119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4-GlyR Syn IRES-EGFP Yes Sternson 119742 ...IRES-EGFP No Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4-GlyR CamKII IRES-EGFP No Sternson 196041 ...

  14. Optogenetics AAV Preps

    Type
    Collection
    ...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden ...Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR tdTomato Cre dependent 5 Boyden 130909 AAV-...AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Boyden 100049 pAAV.hSynap.ChETA...9 Deisseroth 105448 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Syn ChrimsonR (soma-targeted) mRuby2 Cre dependent...Adesnik 124603 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 EF1a ChrimsonR (soma-targeted) mRuby2 Cre ...9 Adesnik 124651 pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 CaMKII ChrimsonR (soma-targeted) mScarlet Constitutive... Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1 Jensen 174007...

  15. Control AAV Preps

    Type
    Collection
    ..., rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 1, 5, 8, 9 Wilson 105532 pAAV.CMV.ffLuciferase.SV40...Constitutive 1, 8 Wilson 105536 pAAV.TBG.PI.Null.bGH TBG none Constitutive 8 Wilson 105541 pENN.AAV.CamKII0.4...Constitutive 1, 5, 9 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP Constitutive 8 Wilson 105542 pENN.AAV.CB7..., 2, 5, 8, 9 Wilson 105543 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG cTNT EGFP Constitutive 9 Wilson 105544 pENN.... PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 5, 8 Wilson 105549 ...Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn TurboRFP Constitutive 1 Wilson 105556 pENN.AAV.tMCK.PI.eGFP.WPRE.bGH...Constitutive 9 Wilson 105557 pENN.AAV.CB7.CI.mCerulean.WPRE.RBG CB7 mCerulean Constitutive 1, 9 Wilson 105598 ...

  16. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson pXCas9H840A ...pyogenes Pederson pLH-nmsgRNA1.1 64115 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1...meningitidis Pederson pLH-stsgRNA2.1 64117 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1... Herold lentiGuide-Crimson 70683 Mammalian/Lentiviral hU6 none S. pyogenes Crimson Bauer BPK2660 70709...pyogenes EGFP Jackson AIO-mCherry 74120 Mammalian U6x2 yes, nick S. pyogenes mCherry Jackson pMZ376 74213...Drosophila BbsI none S. pyogenes O'Connor-Giles, Harrison, Wildonger gRNA_Cloning Vector 41824 Mammalian...Worm BsaI none S. pyogenes Boxem pIK198 65629 Worm Gibson none S. pyogenes Katic pHKMC1: Empty sgRNA for ...

  17. Cre-lox system

    Type
    Collection
    ...Cre CMV AAV Wilson 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...EGFP-Cre fusion CMV AAV Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH Cre GFAP AAV Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...GFP-Cre fusion CamKII AAV Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Cre hSyn AAV Wilson 105555 pENN.AAV.hSyn.Cre.hGH...pENN.AAV.hSyn.Cre.hGH Cre hSyn AAV Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 Cre CamKII AAV Wilson 105603 pAAV.GfaABC1D.PI.Cre.SV40...Khakh 105869 pEMS1925 iCre-ERT2 Simpson 105870 pEMS1725 iCre-ERT2 Simpson 106368 pCMV-Tag2B-NCre N-terminal...AAV.TBG.PI.Cre.rBG Cre TBG AAV Wilson 107788 AAV.rTH.PI.Cre.SV40 Cre rTH AAV Wilson 108454 mCherry-p2A-CreERT2...recombination has occurred, allowing for direct comparison of Cre+ and Cre- cells. While Cre-lox recombination...

  18. Recombinases AAV Preps

    Type
    Collection
    ...pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP 9 Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 CamKII none 1, 5, 9 Wilson CMV Promoter 105537...6.2, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson EF1a Promoter...GFAP none 5, PHPeB Wilson rTH Promoter 107788 AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson PGK Promoter 24593... 9, rg*, PHPeB Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn none 1, 5, 8, 9, rg* Wilson 105555 pENN.AAV.hSyn.Cre.hGH...pENN.AAV.hSyn.Cre.hGH Syn none 9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato... Promoter 107787 AAV.TBG.PI.Cre.rBGe TBG none 8 Wilson Light-Inducible Recombinases ID Name Promoter Fluorophore...

  19. CRISPR Guide

    Type
    Collection
    ...Amrani N, Chen JS, Cofsky JC, Kranzusch PJ, Sontheimer EJ, Davidson AR, Maxwell KL, Doudna JA. Cell . Sep 7...Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. Cell . 167(7):1829-1838. PMID...generally low (<10% of modified alleles). For this reason, many laboratories try to enhance HDR by synchronizing...Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T.. Nat Methods . Nov;15(11):928-931. PMID: 30377374... Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier JM, Anegon I, Lopez...genetic screens with multiple modalities. 2018. Sanson KR, Hanna RE, Hegde M, Donovan KF, Strand C, Sullender...Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu...

  20. Validated gRNA Sequences

    Type
    Collection
    ...23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer...Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere S. pyogenes 26689101 Hudson xylR...ACCATCTAATTCAACAAGAATT 73221 interfere S. pyogenes 26689101 Hudson pgi C. glutamicum TGACCGATCATTACTCAAACTTCC 74066...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2...
Showing: 21 - 40 of 666 results