We narrowed to 17 results for: v5
-
TypeBlog Post...through Addgene. Anti-V5 [IPI-SV5-Pk1] is a recombinant version of the original V5 tag mouse monoclonal...articles. Here's what you'll find in this post: Anti-V5 and other new epitope tag antibodies from IPI New...Ashley Waldron We are excited to highlight the Anti-V5 tag antibody produced by our partners at the Institute... Figure 1: Experimental validation for Anti-V5 [IPI-SV5-Pk1] in a western blot assay. Image reused...et al., 2024 under CC BY license. Find Anti-V5 [IPI-SV5-Pk1] Antibody here! Anderson, Z., Zhu...Moshinsky, D., Meijers, R. (2024). Western Blot for Anti-V5 [IPI-SV5-Pk1]. Addgene Report, https://doi.org/10.57733...
-
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...successfully recombined the single-stranded donor DNA (V5 tag) were quantified by immunocytochemistry assays...the transfection, the entire plate was scanned for V5 tagging using an Operetta imaging system. Dewari ... ICC assay specificity. We generally include Sox2-V5 tagging as a positive control in our knock-in experiments...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if ... -
Pathways Over Time Plasmids Engage Students in Functional Genomics Research
TypeBlog Post...Figure 1) from the two yeast species into the pYES2.1/V5-His yeast overexpression vector. This plasmid contains...the GAL1 promoter. The cloning procedure adds both V5 and His6 epitope tags to the C-termini of Met proteins... -
Tag Your Favorite Yeast Genes with Ease
TypeBlog Post...epitope tag (12xHis, 2xStrep, 3xFlag, Protein A, or V5), and selection marker (KanMX, HphMX, or His3MX).... -
Neurodegeneration Plasmid Collection
TypeCollection...DEST PINK1-V5 G309D PINK1 V5 CMV Parkinson's Mark Cookson 13319 pLenti6-DEST PINK1-V5 KD PINK1 V5 CMV Parkinson's...GS-DJ1-R98Q-V5 PARK7 His, V5 CMV Parkinson's Mark Cookson 29341 pcDNA3.1/GS-DJ1-E18N-V5 PARK7 V5 CMV Parkinson's...GS-DJ1-E18Q-V5 PARK7 V5 CMV Parkinson's Mark Cookson 29343 pcDNA3.1/GS-DJ1-L166P-V5 PARK7 His, V5 CMV Parkinson's...-E64D-V5 PARK7 His, V5 CMV Parkinson's Mark Cookson 29345 pcDNA3.1/GS-DJ1-D149A-V5 PARK7 His, V5 CMV Parkinson's...pLenti6-DJ1-V5-E18N PARK7 V5 CMV Parkinson's Mark Cookson 29413 pLenti6-DJ1-V5-C106D PARK7 V5 CMV Parkinson's...pLenti6-DJ1-V5-L166P PARK7 His, V5 CMV Parkinson's Mark Cookson 29415 pLenti6-DJ1-V5-E18D PARK7 V5 CMV Parkinson's...pLenti6-DJ1-V5-E18Q PARK7 V5 CMV Parkinson's Mark Cookson 29418 pLenti6-DJ1-V5-D149A PARK7 V5 CMV Parkinson's... -
Fluorescent Tagging of Endogenous Genes with SapTrap
TypeBlog Post...N-terminal tagging vectors (eg GFP, Flag, YFP, Strep, TEV-V5) with either blasticidin or puromycin selection. ... -
Neuronal labeling with Spaghetti Monster
TypeBlog Post...viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic peptide FLAG, the synthetic streptavidin-binding... -
Antibodies 101: Immunoprecipitation
TypeBlog Post...cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest on the... -
Plasmids 101: Protein tags
TypeBlog Post...HHSSGLVPRG 12 Solubililty Assists in proper folding V5 GKPIPNPLLGLDST 1.4 Affinity and Purification Good... -
Luciferase Plasmid Collection
TypeCollection...pLX304 Luciferase-V5 blast Firefly CMV Lentiviral expression of firefly luciferase with a V5 tag Kevin Janes...monitor viral transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression... firefly luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression... -
AAV Molecular Tools
TypeCollection...constitutive Expression of ER-localized TurboID (with HA and V5 tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID...Cre-dependent expression of ER-localized TurboID (with HA and V5 tag). 8 Jonathan Long Overexpression Tools These ... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression... -
Institute for Protein Innovation
TypeCollection...search the table below to find antibodies targeting V5, Protein C, DYKDDDDK, Rho, His, Biotin, EE, GCN4 ... -
Sequencing Primers
TypeGuide...Ultrabithorax gene, forward primer V5 Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R... -
Bacterial Expression Systems
TypeCollection...: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA... -
Molecular Biology Reference
TypeGuide...FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK Thrombin... -
Immunology Research Plasmids and Resources
TypeCollection...variable 4-3 IGLV43, V5-1 IGLV4-60 immunoglobulin lambda variable 4-60 IGLV460, V5-4 IGLV4-69 immunoglobulin...immunoglobulin lambda variable 4-69 IGLV469, V5-6 IGLV5-37 immunoglobulin lambda variable 5-37 IGLV537, V4-1 ...IGLV9-49 immunoglobulin lambda variable 9-49 IGLV949, V5-2 IKBKB inhibitor of kappa light polypeptide gene...