Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 69 results
  1. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila... CRISPR gRNAs CRISPR Plasmids: gRNAs Browse CRISPR Plasmids...Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA plasmids designed to... questions to consider when choosing a gRNA: Does a given gRNA sequence exactly match your genomic target...Variation between a given gRNA sequence and your genomic target may reduce the gRNA activity. The variety ...pyogenes , S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible...gRNA expression vectors available from Addgene. CRISPR...
  2. Validated gRNA Sequences

    Type
    Collection
    ... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA Target...Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have...Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA sequence and...pyogenes, S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible...indicate the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene...pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA 72619 cut S... Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: GGCAGGAGAGGCCAGTTGCG 72620 cut S...
  3. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...Type Species PI Lentiviral Generation gRNAs per gene Total gRNAs Adamson DNA Repair CRISPRi Libraries ...Reduced Double-gRNA Library 137999 Knockout Human Parts 3rd 3 59,576 Human Whole Genome sgRNA iBAR Library...46,354 BARBEKO sgRNA Library 174163 Knockout, Base Editing Human Wei 3rd 3 53,502 sgRNA Pool for Streptococcus...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...genome. gRNA Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector...expression of more sgRNAs in a single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs...Empty gRNA expression vectors for insertion of custom gRNA target sequences. CRISPR...target-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and a Cas ...pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock and Port pAc-sgRNA-Cas9 49330...S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach pUC57-sgRNA expression vector...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Halo_C_allele HNRNPA1 Halo ALS Michael Ward 178125 GRN_Halo_C_allele GRN Halo Frontotemporal dementia (FTD) Michael... HNRNPA1 His T7 ALS Tanja Mittag 178944 pAAV-mGrn-myc GRN Myc CBA Frontotemporal dementia (FTD) Erik Roberson... Parkinson's Frank Soldner 180439 STR-KDEL_PGRN-SBP-mCherry GRN SBP-mCherry CMV Frontotemporal dementia...Castañeda 176915 pcDNA3.1(+)_Paragranulin+linker 1 GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas... Kukar 176917 pcDNA3.1(+)_Paragranulin-no linker GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...Thomas Kukar 176918 pcDNA3.1(+)_Granulin 1+linker2 GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...Thomas Kukar 176919 pcDNA3.1(+)_Granulin 1-no linker GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...
  6. CRISPR Guide

    Type
    Collection
    ...System Design gRNA Know your Cell Line Select Gene Select gRNA Clone gRNA Delivery of gRNA & Cas9 Validate...a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein). The gRNA is a short synthetic...how to design your gRNA . Browse Plasmids: gRNAs Synthesize and clone desired gRNAs Once you have selected...commonly referred to as an sgRNA. gRNA scaffold sequence The sequence within the gRNA that is responsible for...protein and the gRNA form a ribonucleoprotein complex through interactions between the gRNA scaffold and ...the gRNA remains free to interact with target DNA. Cas9 will only cleave a given locus if the gRNA spacer...designing a gRNA for your experiment (see Plan Your Experiment below). In addition to optimizing gRNA design...
  7. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...David Liu U6-pegRNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 + H1 pegRNA + nicking sgRNA No mCherry Hyongbum... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...using a prime editing guide RNA (pegRNA). As with a typical gRNA, the pegRNA directs the nickase to the target...nicking sgRNA BbsI No Vermilion Norbert Perrimon pHSG1C3 Mammalian U6 pegRNA + nicking sgRNA BbsI for sgRNAs... PstI for pegRNAs No Xiao Wang pOsU3 Plant OsU3 pegRNA BsaI + HindIII No Caixia Gao pPEgRNA Bacteria J23119...BBa_J23119) pegRNA SpeI + HindIII No Tilmann Weber pnsgRNA Bacteria J23119 (BBa_J23119) nicking sgRNA No Tilmann...
  8. Cheng Lab CRISPR Casilio System

    Type
    Collection
    ...pAC1371-pX-sgRNA-5xPBSa Cloning vector for expression of sgRNA-5xPBSa 71889 pAC1372-pX-sgRNA-15xPBSa Cloning...expression of sgRNA-15xPBSa 71890 pAC1373-pX-sgRNA-25xPBSa Cloning vector for expression of sgRNA-25xPBSa 71891...pAC1374-pX-sgRNA-5xPBSb Cloning vector for transient expression of sgRNA-5xPBSb 71892 pAC1375-pX-sgRNA-15xPBSb...expression of sgRNA-15xPBSb 71893 pAC1376-pX-sgRNA-25xPBSb Cloning vector for expression of sgRNA-25xPBSb 71894...pAC1379-pX-sgRNA-5xPBSw Cloning vector for expression of sgRNA-5xPBSw 71895 pAC1380-pX-sgRNA-5xPBSc Cloning...expression of sgRNA-5xPBSc 71898 pAC1394-pX-sgRNA-0xPBS Cloning vector for expression of sgRNA without PBS...pAC1399-pX-sgRNA-20xPBSc Cloning vector for expression of sgRNA-20xPBSc 71917 pAC1420-pX-sgRNA-1xPBSa Cloning...
  9. CRISPR References and Information

    Type
    Collection
    ...Cas9 ; pUC gRNA Shuttle PDF 488.6 KB Sabatini and Lander gRNA cloning into pLX-sgRNA pLX-sgRNA PDF 125.9... protocol Church gRNA design and cloning gRNA cloning vector PDF 115.2 KB Church gRNA design and cloning...Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA empty backbone (pDR274) PDF 87.2 KB Liu Fly: gRNA cloning pAc-sgRNA-Cas9...the Chan Zuckerberg Biohub . gRNA Design Deep learning models to design gRNAs and predict their efficiency...Chen and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized ...optimized Cas9 PDF 66.8 KB Fujii gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo... PDF 107.4 KB Goldstein Nematode: gRNA design and cloning Cas9-sgRNA construct PDF 355.3 KB Goldstein ...
  10. Zhang Lab CRISPR Page

    Type
    Collection
    ...described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro (sgRNA) Browse...CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600; CMV-driven... SaCas9 sgRNA can be co-transfected as PCR amplicons using a protocol similar to SpCas9 sgRNA PCR (Ran... pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH...implemented by delivering Cre and sgRNA to a Cre-dependent mouse or sgRNA to a constitutively Cas9-expressing...control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone...
  11. Church Lab CRISPR Plasmids

    Type
    Collection
    ...41817 gRNA_AAVS1-T1 A gRNA to human AAVS1 41818 gRNA_AAVS1-T2 A gRNA to human AAVS1 41819 gRNA_GFP-T1 A... A gRNA to GFP 41820 gRNA_GFP-T2 A gRNA to GFP 41821 gRNA_DNMT3a-T1 A gRNA to DNMT3a 41822 gRNA_DNMT3a-T2...synthesizing gRNAs: hCRISPR gRNA synthesis protocol 115.2 KB A genome-wide resource of ~190k unique gRNAs targeting...gRNA_DNMT3a-T2 A gRNA to DNMT3a 41823 gRNA_DNMT3b A gRNA to DNMT3b Yeast System: Table 2 To function in yeast cells...41824 gRNA Empty Vector The backbone that a target sequence gets cloned into to create the gRNA 41815 ...as a gRNA expression construct using the SNR52 snoRNA promoter. A protocol for synthesizing gRNAs: hCRISPR...from the GalL promoter 43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t A gRNA expression plasmid for use in S. cerevisiae...
  12. CRISPR Plasmids - Plants

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...Chen pU3-gRNA OsU3 AarI none S. pyogenes Gao pZmU3-gRNA maize U3 none S. pyogenes Gao pU6-gRNA wheat U6...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...
  13. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Publication Empty gRNA Expression Vectors You can use the tables on Addgene's Empty gRNA Vectors page to...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  14. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ....1016/j.bbrc.2013.08.013. Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  15. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  16. CRISPR Plasmids - Yeast

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  17. Lentiviral Prep Service

    Type
    Collection
    ...pooled libraries 73178 Human sgRNA library Brunello in lentiGuide-Puro Human sgRNA library in backbone lentiGuide-Puro... Doench , Root 73179 Human gRNA pooled library in lentiCRISPRv2 Human sgRNA library in backbone lentiCRISPRv2...Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa sgRNA activation...containing 56,762 unique sgRNAs. This backbone does not contain dCas9. 56,762 unique sgRNAs targeting 18,885 ...pooled libraries 73633 Mouse sgRNA library Brie in lentiGuide-Puro Mouse sgRNA library in backbone lentiGuide-Puro...RNA guide (gRNA) that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting...of Cas9 + ACE2 gRNA Sheltzer 153015 TMPRSS2 g1 + Cas9 Expression of Cas9 + TMPRSS2 gRNA Sheltzer Return...
  18. Qi Lab CRISPR Page

    Type
    Collection
    ...resistance. The second plasmid ( pgRNA_bacteria ) contains a constitutive sgRNA expression cassette on a ColE1...The second plasmid ( pgRNA_humanized ) contains a murine U6 promoter controlled sgRNA cassette, wherein ... fusion expression plasmid 44248 pgRNA-humanized A customizable gRNA expression plasmid for use with either...use editing bacterial genomes 44251 pgRNA-bacteria A customizable gRNA expression plasmid for use with the...CRISPR CRISPRi Cas9 gRNA plasmids from the Qi lab CRISPR...You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts We have recently ...dCas9) protein and a customized s ingle g uide RNA (sgRNA) designed with a 20-basepair complementary region...
  19. CRISPR Plasmids - C. elegans

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...PU6::klp-12_sgRNA cU6 PCR (see paper) Transfection none, need Cas9 plasmid Calarco SP6-sgRNA-scaffold ...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  20. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...example, sgRNA-A’s protospacer sequence and PAM happen to fall on the bottom (Crick) strand while sgRNA-B’s...primers flanking each sgRNA target site (within 150 - 350 bp) to amplify the sgRNA target site to examine...complement: 1.0 μl sgRNA 24- or 25-mer oligo (100 μM; see step 1.4 ), 1.0 μl sgRNA 24- or 25-mer reverse...composed of a polyclonal population exposed to sgRNA-A and sgRNA-B (see step 5 ). The purpose of the following...delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a...posted at the top of the page. CRISPR Design Design sgRNAs manually or using freely available online tools...non-coding elements. For creating a gene knockout, two sgRNA located within exons will enrich even monoallelic...
Showing: 1 - 20 of 69 results