Skip to main content

We narrowed to 101 results for: EPO

Showing: 21 - 40 of 101 results
  1. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...with EF1alpha addition of an mCherry reporter variant nuclear reporters via an H2B fusion shuttle plasmid... Depositor Collections Brzezinski Lab CRISPR Collection Brzezinski...advantage of the Zhang lab all-in-one (guide/Cas9/reporter) pX458 plasmid family. They have made several ...
  2. Lentiviral Prep Service

    Type
    Collection
    ... made from plasmids that are currently in our repository. You can obtain the plasmid from us or receive...on each item's material page. Actual titers are reported with each shipment. For more details about our... that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific...of available viruses based on plasmids in our repository that express fluorescent proteins. ID Name Insert...
  3. TALEN Plasmids and Kits

    Type
    Collection
    ...repeat arrays. TALEN Kits TALEN Kit Description Depositing PI FusX TALEN Assembly System Contains 336 pFusX...with Addgene TALEN Kits For Use With: ID Plasmid Depositing PI Description Golden Gate TALEN 2.0 38142 RCIscript-GoldyTALEN... pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based validation assay...N- and C-terminal domains (N153AA, C47AA). The reporter vector pGL4-SSA can be used for single-strand ...
  4. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Plasmids Recombinase-Dependent Empty Backbones Reporter Plasmids Pooled Libraries/Kits Site-specific recombinase...recombinases , as well as useful empty backbones or reporters . Experimental Considerations Recombinase Recognition... plasmids. Return to top Recombinase-Dependent Reporter Plasmids Incorporating a fluorescent protein into...visualize which cells have undergone recombination. Reporter plasmids can also be useful for lineage tracing...
  5. Synthetic Biology - Cloning and Genomic Tools

    Type
    Collection
    ...systems. Jump to Table: Cloning and Genomic Tools Reporters and Tags Library Construction Integration Recombination...link to view all plasmids available from this depositor's lab. Plasmid Description Gene/Insert Vector Type...link to view all available plasmids from this depositor's lab. Plasmid Description Vector Type Selectable...
  6. Plasmids for Stem Cell Research

    Type
    Collection
    ...induced reprogramming to pluripotency. Stem Cell Reports. 2015 Apr 14;4(4):727-43. Woltjen Plasmid Mouse...self-regulating and nonintegrating viral vectors. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. Jaenisch...Cells and B Lymphocytes to Neural Stem Cells. Cell Reports. 2014 Dec 11;9(5):1673-80. Parmar Fibroblasts Astrocytes...astrocytes by defined transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory...
  7. KLF Research Plasmids

    Type
    Collection
    ...Learn about the benefits of depositing plasmids with Addgene or email deposit@addgene.org to get started...Collections KLF Plasmids Plasmids for KLF Research KLF Depositing Labs Juan Belmonte Linzhao Cheng Jose Cibelli...
  8. NETRF

    Type
    Collection
    ...Addgene Depositors that have received funding from the Neuroendocrine Tumor Research Foundation... the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution ...
  9. AAV Viral Preps

    Type
    Collection
    ...on each item's material page. Actual titers are reported with each shipment. If you can't find the prep...service. You can choose a transfer plasmid from our repository and request packaging in one of seven serotypes...Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster...
  10. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...the Addgene collection? Click here to start the deposit process and have your plasmids added to the list...addgene.org for more information and assistance with the deposit process. Want more information on the wide variety...publication or plasmid information page, or contact the depositing PI for more information on the experimental use...
  11. Biosensor AAV Preps

    Type
    Collection
    ...GRAB_OTmut (control) none Constitutive 1, 9 Li Voltage Reporter: Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-...Syn Archon1 EGFP Cre dependent 8 Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn ...Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter: JEDI-2P 179459 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE ... JEDI-2P none Constitutive 9 St-Pierre Voltage Reporter: ASAP 225707 pAAV-hsyn-ASAP5-Kv2.1-WPRE Syn ASAP5...
  12. Serotype Testing AAV

    Type
    Collection
    ...Serotype Testing AAV These AAV encode fluorescent reporters and can be used to compare the tropism of different...injection. These AAV are made from plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from...injection. These AAV are made from plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from...
  13. Worm Expression Resources

    Type
    Collection
    ... aren't in the repository? Help us widen our resources for the community by depositing your useful tools...elegans genome is well studied and hundreds of reporters have been developed and characterized which allow...
  14. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...The Allen Institute for Cell Science has deposited plasmids to generate fluorescently tagged proteins... Depositor Collections Allen Institute for Cell Science Plasmid...plasmids used to generate these lines have been deposited here with Addgene for distribution to the research...
  15. AAV Packaged on Request

    Type
    Collection
    ... availability at affordable prices. While our repository serves the needs of many researchers, scientists...recombinase, and biosensor transfer plasmids in our repository are eligible for this service. Select any eligible...eligible plasmid in the Addgene repository in your choice of seven serotypes and four volumes. Details ...
  16. Genetic Code Expansion

    Type
    Collection
    ... are true. Always express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian...synthetase E. coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG Jesse Rinehart...RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP all...removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 No TCG, TCA, or TAG...
  17. Brain Initiative Collection

    Type
    Collection
    ...Initiative below. Support has been identified by depositors and/or when BRAIN Initiative grants are noted...plasmid encoding for Archon1 fluorescent voltage reporter, Cre-dependent expression Edward Boyden 108912...128485-AAV9 pAAV-CAG-iSeroSnFR-Nlgn Fluorescent reporter for serotonin (dendrite localization tag) Lin ...selected set of plasmids that are currently in our repository. AAV are distributed as 100 µL of purified viral...
  18. Lentivirus Plasmids

    Type
    Collection
    ...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler...transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452...
  19. Validated gRNA Sequences

    Type
    Collection
    ...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...possible on the sequences, and email the file to deposit@addgene.org with the subject heading "gRNA sequence...
  20. Zinc Finger Consortium Reagents

    Type
    Collection
    ...engineering and expressing zinc finger proteins deposited by Zinc Finger Consortium members like the Joung...Consortium members Keith Joung and Daniel Voytas have deposited at Addgene various reagents for engineering and...
Showing: 21 - 40 of 101 results