...Addgene’s deposit agreements allow Addgene to distribute plasmids on behalf of the depositing institutions...legal agreement between the recipient and the depositing institution(s). It governs the transfer of biological...entity is qualified to receive materials from our repository. All purchases are subject to Addgene’s Terms...

...Lentiviral Vectors deposited by Kazuhiro Oka from the Baylor College of Medicine Gene Vector Core...Core (Link opens in a new window) have kindly deposited a series of lentiviral and adenoviral transfer...set of lentiviral transfer vectors you can find reporter plasmids to test whether or not you've efficiently...to generate adenovirus expressing a variety of reporters as well as the Cre and Flp recombinases. Genes...

... made from plasmids that are currently in our repository. You can obtain the plasmid from us or receive...on each item's material page. Actual titers are reported with each shipment. For more details about our... that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific...of available viruses based on plasmids in our repository that express fluorescent proteins. ID Name Insert...

...repeat arrays. TALEN Kits TALEN Kit Description Depositing PI FusX TALEN Assembly System Contains 336 pFusX...with Addgene TALEN Kits For Use With: ID Plasmid Depositing PI Description Golden Gate TALEN 2.0 38142 RCIscript-GoldyTALEN... pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based validation assay...N- and C-terminal domains (N153AA, C47AA). The reporter vector pGL4-SSA can be used for single-strand ...

...systems. Jump to Table: Cloning and Genomic Tools Reporters and Tags Library Construction Integration Recombination...link to view all plasmids available from this depositor's lab. Plasmid Description Gene/Insert Vector Type...link to view all available plasmids from this depositor's lab. Plasmid Description Vector Type Selectable...

...induced reprogramming to pluripotency. Stem Cell Reports. 2015 Apr 14;4(4):727-43. Woltjen Plasmid Mouse...self-regulating and nonintegrating viral vectors. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. Jaenisch...Cells and B Lymphocytes to Neural Stem Cells. Cell Reports. 2014 Dec 11;9(5):1673-80. Parmar Fibroblasts Astrocytes...astrocytes by defined transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory...

...Learn about the benefits of depositing plasmids with Addgene or email deposit@addgene.org to get started...Collections KLF Plasmids Plasmids for KLF Research KLF Depositing Labs Juan Belmonte Linzhao Cheng Jose Cibelli...

...Addgene Depositors that have received funding from the Neuroendocrine Tumor Research Foundation... the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution ...

...the plasmids that are available from Addgene's depositing scientists....is a Monomer not a Monomer? Addgene's plasmid repository contains a variety of fluorescent protein plasmids...the plasmids that are available from Addgene's depositing scientists. Browse Fluorescent Protein Plasmids...

...on each item's material page. Actual titers are reported with each shipment. If you can't find the prep...service. You can choose a transfer plasmid from our repository and request packaging in one of five serotypes...Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster...

...the Addgene collection? Click here to start the deposit process and have your plasmids added to the list...addgene.org for more information and assistance with the deposit process. Want more information on the wide variety...publication or plasmid information page, or contact the depositing PI for more information on the experimental use...

...Serotype Testing AAV These AAV encode fluorescent reporters and can be used to compare the tropism of different...injection. These AAV are made from plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from...injection. These AAV are made from plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from...

... aren't in the repository? Help us widen our resources for the community by depositing your useful tools...elegans genome is well studied and hundreds of reporters have been developed and characterized which allow...

...The Allen Institute for Cell Science has deposited plasmids to generate fluorescently tagged proteins... Depositor Collections Allen Institute for Cell Science Plasmid...plasmids used to generate these lines have been deposited here with Addgene for distribution to the research...

... availability at affordable prices. While our repository serves the needs of many researchers, scientists...recombinase, and biosensor transfer plasmids in our repository are eligible for this service. Select any eligible...eligible plasmid in the Addgene repository in your choice of: serotype (AAV1, AAV2, AAV5, AAV8, or AAVrg...

... are true. Always express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian...synthetase E. coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG Jesse Rinehart...RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP all...removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 No TCG, TCA, or TAG...

...Initiative below. Support has been identified by depositors and/or when BRAIN Initiative grants are noted...plasmid encoding for Archon1 fluorescent voltage reporter, Cre-dependent expression Edward Boyden 108912...128485-AAV9 pAAV-CAG-iSeroSnFR-Nlgn Fluorescent reporter for serotonin (dendrite localization tag) Lin ...selected set of plasmids that are currently in our repository. AAV are distributed as 100 µL of purified viral...

...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler...transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452...

...GRAB_OTmut (control) none Constitutive 1, 9 Li Voltage Reporter: Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-...Syn Archon1 EGFP Cre dependent 8 Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn ...Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter: JEDI-2P 179459 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE ...

...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...possible on the sequences, and email the file to deposit@addgene.org with the subject heading "gRNA sequence...