We narrowed to 40 results for: Lor;
-
TypeCollection...translational technologies. Biotechnology companies are exploring therapeutic applications of CRISPR to treat genetic...Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal loci in human ...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol Marraffini... -
Cre-lox system
TypeCollection...marking of mouse neurons with multiple distinct colors Mammalian Sanes See article Multibow constructs...dependent tdtomato expression. See article for more colors. Mammalian Zeng 24334 hsp70l-loxP-mCherry-STOP-... -
Michael Davidson Fluorescent Protein Collection
TypeCollection... Optogenetics The lab of Michael Davidson from Florida State University has contributed their comprehensive... -
Institute for Protein Innovation
TypeCollection...anti-glypicans that accurately detect glypican presence and explore glypican function, providing a reliable and accessible... -
Optogenetics Plasmid Collection
TypeCollection... cells. Other microbial opsins, such as the Halorhodopsins, Archaerhodopsins and Leptosphaeria rhodopsins... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...George N, Krumm H, Johnsson K, Johnsson N. 2005. Multicolor imaging of cell surface proteins. J Am Chem Soc... -
CRISPR Plasmids - Prime Edit
TypeCollection... improve the efficiency of editing, including exploring new sources for the reverse transcriptase. Many... -
CRISPR Plasmids - Bacteria
TypeCollection...Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes, cut Marraffini 44251 pgRNA-bacteria BBa_J23119... -
Fluorescent Protein Guide: FRET
TypeCollection...interest and the listed fluorescent protein. Plasmid Color Expression Description pPROEX Aqua Cyan Bacterial... -
Zebrafish Plasmid Collection
TypeCollection...Lab Zebrabow - Albert Pan and Alex Schier Labs. Multicolor fluorescent labeling in zebrafish Whole organism... -
Open Enzyme Collection
TypeCollection...E overhangs for Golden Gate assembly. Plasmids Explore the collection and order individual plasmids via... -
Control AAV Preps
TypeCollection...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Yale University changed the way researchers can explore important questions surrounding serine phosphorylation... -
Optogenetics AAV Preps
TypeCollection...AAV collection, including channelrhodopsins, halorhodopsins, and more.... -
Retrograde AAV viral preps
TypeCollection...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a Color-flipping switch. Expresses NLS-mCherry in the absence... -
Bacterial Expression Systems
TypeCollection... pRSETa mEos2 20341 mEos2 (fluorescent protein) Loren Looger Photoactivable Fluorescent Protein Expression... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library 178284 Knockout Green ... -
Validated gRNA Sequences
TypeCollection...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462... -
Immunology Research Plasmids and Resources
TypeCollection...inflammation, the different cytokines that are released tailor the immune response to a specific trigger. Interferons...inflammation, the different cytokines that are released tailor the immune response to a specific trigger. Symbol...