Skip to main content
Addgene
Showing: 21 - 40 of 71 results
  1. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin...Proliferating cell nuclear antigen (PCNA) DNA replication foci IPSC cell lines can be ordered from the ...the Allen Institute for Cell Science Cell Catalog (Link opens in a new window) . Protocols The Allen Institute...
  2. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed by another vector pCDH-EF1...pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed by another vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro...vector pCDH-EF1-FLPe 72262 Expresses FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from...copGFP from a truncated EF1 promoter pCDH-EF1S-Nluc 73033 Expresses Nluc from a truncated EF1 promoter ...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...
  3. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...library as GST-fusion peptides (“mode #1” expression). The mode #1 phosphosite library ( 111704 ) is available...standards for quantitative assessments. The mode #1 phosphosite library can be generated with either phosphoserine...available from Addgene. Screening kinases. The mode #1 phosphosite library can also be synthesized using ...pSerOTS-C1* (V70) Pooled Library 188526 iSPI_pSer_Subpool#1 Pooled Library 188527 iSPI_pSer_Subpool#2 Pooled Library...split mCherry 14-3-3β Pooled Library 111704 Mode #1 Library Pooled Library 111705 Mode #2 Library (14-...partial UAG codon reassignment and release factor 1 deletion. Heinemann IU, Rovner AJ, Aerni HR, Rogulina...the most abundant forms of posttranslational modifications in cells and research into its many roles in...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [...Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST... His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...Cookson 29350 pGEX-5X-1-DJ1-WT PARK7 GST tac Parkinson's Mark Cookson 29351 pGEX-5X-1-DJ1-D149A PARK7 GST...Cookson 29352 pGEX-5X-1-DJ1-E64D PARK7 GST tac Parkinson's Mark Cookson 29353 pGEX-5X-1-DJ1-M26I PARK7 GST...
  5. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...endogenous repair mechanisms. Cas3 belongs to the Class 1 family of CRISPR systems, the most abundant type found...bacteria and archaea. While abundant in nature, Class 1 systems are largely underutilized compared to their...still separate the individual Cas components. Figure 1: Overview of Cascade-Cas3 mechanism. Created with ...Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other...
  6. Validated gRNA Sequences

    Type
    Collection
    ...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT...S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes 25491644 Ward...RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA... S. pyogenes 25161212 Fire rde-1(H974) C. elegans GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 ...
  7. Plasmids for Stem Cell Research

    Type
    Collection
    ...reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1... with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human...vector. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse... from Human ALS Patients. Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral... into Neurons. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. Next generation vectors for transcription factor...
  8. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous Type II bacterial...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...
  9. Lentivirus Plasmids

    Type
    Collection
    ...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures...". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance...plasmid 24150 for hygro resistance. Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid... EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...included to monitor expression Parijs 11619 pLB 3rd Modification of pLL3.7; Genetic elements known to prevent...
  10. Lentiviral Prep Service

    Type
    Collection
    ...Barcode Library Version 1 Ready-to-use lentiviral particles carrying version 1 of the CellTag barcoding...barcoding library. Version 1 of the Celltag library contains 19973 barcodes to combinatorially index cells for... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
  11. Zhang Lab CRISPR Page

    Type
    Collection
    ...Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6...SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase) + single guide ...screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together...):186-91. doi: 10.1038/nature14299. Epub 2015 Apr 1. PubMed . Return to AAV In vivo plasmids AAV Plasmids... nuclease along with the guide RNA. For most applications, we recommend using Cas9 with the single guide...BbsI, and a pair of annealed oligos (design is indicated below) can be cloned scarlessly into the vector...BbsI, and a pair of annealed oligos (design is indicated below) can be cloned into the CRISPR array. The...
  12. Mammalian RNAi Tools

    Type
    Collection
    ...Plasmid Vector Type PI Publication Additional Resources Addgene Resources pLKO.1 cloning vector protocol... design and delivery, see resources below. Figure 1: Overview of shRNA-mediated RNA interference. Created...
  13. AAV for Neuronal Tracing

    Type
    Collection
    ...rabies virus (RABV) for monoclonal neuronal tracing. (1) AAV encoding TVA and G-protein is delivered to the...with a deletion-mutant rabies virus. Nat Methods. 4(1):47-9. PMID: 17179932 Wickersham IR, Lyon DC, Barnard...which is not required for the transcription or replication of the genome within infected cells, but is required... cells that lack the G protein, the virus can replicate but the newly formed viruses are unable to infect...starter cell via the EnvA receptor. RABV is able to replicate in the starter cell using the G-protein, which...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  14. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Bullock and Port 49411 pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription...O'Connor-Giles, Harrison, Wildonger 49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...
  15. Brain Initiative Collection

    Type
    Collection
    ...element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV5 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV8 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV9 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons... Gordon Fishell 83900-AAVrg pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons... Gordon Fishell 83900-PHPeB pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...
  16. Antibody Plasmid Collection

    Type
    Collection
    ... Commun. 2015 Jan 2;456(1):527-33. Gavin Wright pET-30-based vector dedicated to efficient scFv expression...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...extensively validated for neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb...imaging. Learn more about antibodies and their applications in our Antibody Guide ! Cloning and Expressing...antibodies, and Fc-silent mutants. Functional diversification of hybridoma-produced antibodies by CRISPR/...and Generation of synthetic nanobodies against delicate proteins. Nat Protoc. 2020 Apr 8. Markus Seeger...
  17. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...effects in vivo . While AAVs can be handled at BSL-1, AAVs expressing oncogenes or toxins should be handled...Addgene ID Plasmid Capsid Description PI 112862 pAAV2/1 AAV1 AAV packaging plasmid, expressing Rep2 and Cap1...advantage of using AAV for research is that it is replication-limited and typically not known to cause disease...certain exogenous gene products that mediate AAV replication. This requirement has been circumvented with ...expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Viviana Gradinaru 103006 pUCmini-iCAP-PHP.S...expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Viviana Gradinaru 127847 pUCmini-iCAP-PHP.V1...expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10...
  18. CRISPR Guide

    Type
    Collection
    ...editing efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir,... DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott...CRISPR-Cas9 to increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, ...with an engineered chimeric Cas9. Nature Communications , 14 (1), 6175. PMID: 37794046 Small precision ...integration by homology-dependent repair. Nature Communications . 9 (1), 1133. PMID: 29556040 Chen, P. J., Hussmann...transcriptional reprogramming in bacteria. Nature Communications . 9 (1), 2489. PMID: 29950558 Fujita, T., & Fujii.... Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID: 23942116 Gilbert, L. A...
  19. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral...Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/...Puro Zoldos pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes...
  20. Deisseroth INTRSECT Collection

    Type
    Collection
    ...populations defined by multiple parameters. Figure 1: Examples of intersectional cell population definitions... as a proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach...interneurons encode fear memory. Nat Neurosci. 23(1):61-74. PubMed (Link opens in a new window) Hafner...Itch-Scratching Cycle via Descending Regulation. Neuron 101(1):45-59. PubMed (Link opens in a new window) Lazaridis...inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene...
Showing: 21 - 40 of 71 results