We narrowed to 65 results for: control
-
TypeCollection...proteins, including calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors... 140555 pAAV-hsyn-GRAB_DA-mut Syn GRAB_DA-mut (control) none Constitutive 9 Li 140556 pAAV-hsyn-GRAB_rDA1m...140558 pAAV-hsyn-GRAB_rDA-mut Syn GRAB_rDA-mut (control) none Constitutive 9 Li 208702 pAAV-hSyn-GRAB-rDA3m...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...pGP-AAV-syn-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218877 pGP-AAV-syn-flex-iGABASnFR2...-flex-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Cre dependent 1, 5 GENIE Glutamate Sensor...Li 123310 pAAV-hSyn-GRAB_NEmut Syn GRAB_NEmut (control) none Constitutive 9, rg* Li 208687 pAAV-hsyn-NE2h...
-
Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection
TypeCollection... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library...reading frames with or without GFP and mCherry controls. Do you have suggestions for other plasmids that... -
DNA Service - Cloning Grade DNA
TypeCollection...find current pricing information Standard Quality Control Plasmid verified by next generation sequencing ...Plasmid Description Industry PI FAQ What Quality Control analyses are performed on my cloning grade DNA ... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...production process and quality control, with examples of quality control data. Help Center Articles Additional... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range...reporters, mCherry and sfgfp in this case, can be controlled using a plasmidāborne CRISPR array coding for... -
Deisseroth INTRSECT Collection
TypeCollection...recombinase recognition sequences enables directional control of the portion of the ORF that is sandwiched between... INTRSECT recombinases, viruses, and important controls to consider as part of experimental design. How-to..., Paninski L, Li B. 2017. The central amygdala controls learning in the lateral amygdala. Nat Neurosci...Meletis K. 2019. A hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PubMed... -
Worm Expression Resources
TypeCollection...silencing in the germline. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. - ...Hubbard Lab. Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression... -
mTOR Pathway
TypeCollection...apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation. mTOR, a serine...Kris Wood) References mTOR signaling in growth control and disease. Laplante M, Sabatini DM. Cell. 2012...in cancer promotes the conditions needed for uncontrolled cell growth and proliferation, including an ... -
Tags and Other Markers
TypeCollection...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs... -
Neuroscience
TypeCollection...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs... -
Synthetic Biology - Metabolism
TypeCollection...Biofuels Natural Product Pathways Efflux Pumps Flux Control Metabolism Plasmids Search the table by keyword... -
Fluorescent Protein Guide: Activity Regulation
TypeCollection...factors Connie Cepko See Plasmids Dronpa Optical control of protein activity Michael Lin See Plasmids Do... -
Zebrafish Plasmid Collection
TypeCollection...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression... -
Fluorescent Protein Guide: FRET
TypeCollection...mTurquoise2 Brightness standard used as positive control to characterize mTurquoise2 pmTurquoise2-T2A-Venus...T2A-Venus(L68V) Brightness standard used a negative control (no FRET) with pmVenus(L68V)-mTurquoise2 Back to... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...production , these viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and...pTR-UF11 chimeric CMV/Chicken Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F... -
Validated gRNA Sequences
TypeCollection...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ... -
Fluorescent Protein Guide
TypeCollection...Plasmids | Guide Use light to detect, measure, and control molecular signals, cells, or groups of cells with... -
Structural Genomics Consortium Plasmids
TypeCollection...Bacterial Expression Plasmids (empty backbones/controls): ID Plasmid GenBank Key Features 26092 p15TV-... -
All Antibodies
TypeCollection...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs... -
Zhang Lab CRISPR Page
TypeCollection...recombinase, and Kras G12D HDR template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase...within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA(backbone...targeting the neuronal-specific gene NeuN. As a control they designed an sgRNA targeting LacZ, which is...