...pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz 60323 pGL4.23...fusions in plants. Renilla luciferase under the control of a CMV promoter is present for normalization ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization Ting Ni ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization. Modified...TM) Renilla Vector for investigating regions controlling transcription Pete Stecha 212933 pGL4.84(hRlucCP...

...application-specific validation and consistent quality control measures. We work with trusted partners and experts... by sharing our protocols and quality control methods. Learn More Guide New to using antibodies...

...proteins, including calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors... 140555 pAAV-hsyn-GRAB_DA-mut Syn GRAB_DA-mut (control) none Constitutive 9 Li 140556 pAAV-hsyn-GRAB_rDA1m...140558 pAAV-hsyn-GRAB_rDA-mut Syn GRAB_rDA-mut (control) none Constitutive 9 Li 208698 pAAV-hSyn-GRAB-gDA3m...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...pGP-AAV-syn-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218877 pGP-AAV-syn-flex-iGABASnFR2...-flex-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Cre dependent 1, 5 GENIE Glutamate Sensor...Li 123310 pAAV-hSyn-GRAB_NEmut Syn GRAB_NEmut (control) none Constitutive 9, rg* Li 187179 pAAV_hSyn1_...

... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library...reading frames with or without GFP and mCherry controls. Do you have suggestions for other plasmids that...

...find current pricing information Standard Quality Control Plasmid verified by next generation sequencing ...Plasmid Description Industry PI FAQ What Quality Control analyses are performed on my cloning grade DNA ...

...production process and quality control, with examples of quality control data. Help Center Articles Additional...

...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range...reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array coding for...

...recombinase recognition sequences enables directional control of the portion of the ORF that is sandwiched between... INTRSECT recombinases, viruses, and important controls to consider as part of experimental design. How-to..., Paninski L, Li B. 2017. The central amygdala controls learning in the lateral amygdala. Nat Neurosci...Meletis K. 2019. A hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PubMed...

...silencing in the germline. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. - ...Hubbard Lab. Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...

...apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation. mTOR, a serine...Kris Wood) References mTOR signaling in growth control and disease. Laplante M, Sabatini DM. Cell. 2012...in cancer promotes the conditions needed for uncontrolled cell growth and proliferation, including an ...

...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs...

...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs...

...Biofuels Natural Product Pathways Efflux Pumps Flux Control Metabolism Plasmids Search the table by keyword...

...factors Connie Cepko See Plasmids Dronpa Optical control of protein activity Michael Lin See Plasmids Do...

...bacteriophage, is a potent and specific system for controlling gene expression. The protein Cre recombinase ...specific times or locations, you can precisely control expression of your gene of interest. Many Cre constructs...Plasmids Scientists have developed ways to tightly control Cre expression and to optimize Cre expression once...NCre and CCre, respectively) and placed under the control of different promoters. Expression of both N and... 49455 pSH62-EBD Cre-EBD - Estradiol-dependent control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70...FLP/FRT: Alternative recombinase system for the control of gene expression. Flp recombinase recognizes ...):6232-6. PubMed . Matsuda T, Cepko CL. 2007. Controlled Expression of Transgenes Introduced by In Vivo...

...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...

...mTurquoise2 Brightness standard used as positive control to characterize mTurquoise2 pmTurquoise2-T2A-Venus...T2A-Venus(L68V) Brightness standard used a negative control (no FRET) with pmVenus(L68V)-mTurquoise2 Back to...

...production , these viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and...pTR-UF11 chimeric CMV/Chicken Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F...

...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

...Plasmids | Guide Use light to detect, measure, and control molecular signals, cells, or groups of cells with...