Skip to main content
Addgene

We narrowed to 110 results for: CAL

Showing: 41 - 60 of 110 results
  1. COVID-19 Resources

    Type
    Collection
    ...novel virus strain from the Coronaviridae family called SARS-CoV-2. Scientists have been working at lightning... enzyme that cleaves precursor proteins to a biologically active state. The SARS-CoV-2 S protein contains...Cas13a ( pC013 ) for detection of SARS-CoV-2: A Scalable, Easy-to-Deploy, Protocol for Cas13-Based Detection...Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor . FURIN - Andersen,...
  2. Plan Your Experiment

    Type
    Collection
    ...EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain reporter gene (e.g. ...needs to match the target locus, but it is also critical to ensure that the gRNA target sequence does NOT...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...additional sites throughout the genome. These sites are called off-targets and should be examined during gRNA ...
  3. Cell Migration Consortium Plasmids

    Type
    Collection
    ...deposited plasmids include: Joan Brugge , Harvard Medical School Klaus Hahn , UNC Richard Hynes , MIT Rick...University of Virginia Denise Montell , University of California, Santa Barbara Martin Schwartz , Yale University...University of Illinois Ron Vale , University of California, San Francisco Browse Plasmids ID Plasmid Gene...
  4. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Biosensors Optogenetics Background Fluorescent...to use these fluorescent proteins to modulate biological activity. Early tools allow scientists to regulate...transcription factors Connie Cepko See Plasmids Dronpa Optical control of protein activity Michael Lin See Plasmids...
  5. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael Davidson from...the ORFs are of mammalian origin and include localization data found below. In addition, the Davidson ...Expressions website for additional images, tutorials, optical microscopy protocols and resources. Or read our...
  6. Luciferase Plasmid Collection

    Type
    Collection
    ...Resonance Energy Transfer (BRET) CalFlux VNT : An intracellular calcium sensor created by fusing NanoLuc...ability of a given lncRNA to cis-repress Mauro Calabrese 106253 pLS-mP-Luc Firefly Insertion of 5' promoter...Malcolm Moore 51819 Syn-ATP Firefly (modified) CMV Optical reporter of presynaptic ATP Timothy Ryan 24348 ...
  7. AAV Viral Preps

    Type
    Collection
    ...Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1, MaCPNS1...serotypes AAV1, AAV2, AAV5, AAV8, AAV9, AAVrg, the Caltech systemic serotypes, or others, it will be listed...
  8. Plant Plasmids and Resources

    Type
    Collection
    ...repository contains many plasmid tools that were specifically designed for use in plants. These resources ...MoClo Plant Parts II and Infrastructure Kit for hierarchical assembly of plant multigene constructs - Johannes...an Old Favorite External Resources Arabidopsis Biological Resource Center (ABRC) (Link opens in a new window...
  9. Lentiviral Prep Service

    Type
    Collection
    ...libraries to screen for genes involved in specific biological processes. For more information, see our Guide...pooled libraries 92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
  10. Validated gRNA Sequences

    Type
    Collection
    ...GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut...TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...
  11. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...Resources: Empty Backbones Biosensors Subcellular localization Optogenetics Background Förster resonance energy...acceptor molecules and can therefore be used to calculate the distances between the donor and acceptor. ...were developed to be used as FRET standards to calibrate the numerous and disparate methods used to measure...
  12. CRISPR Plasmids - Plants

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...
  13. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Masato Kanemaki's lab has developed a simple and scalable CRISPR/Cas-based method to tag endogenous proteins...Geraldine Seydoux's lab has developed a systematic and scalable method to create marker-free mutations, insertions...co-integrated markers or footprints, and can be scaled up for systematic editing of multiple genes. Plasmids...
  14. CRISPR References and Information

    Type
    Collection
    ...collection of CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation...sgRNAs, genes, or pathways. For use with genome-scale CRISPR-Cas9 knockout screens (or GeCKO) technology...all-around platform for CRISPR knock-in design at scale. It uses an open-source algorithm to automate and...
  15. Zhang Lab CRISPR Page

    Type
    Collection
    ... genes. It consists of three components: A nucleolytically inactive Cas9-VP64 fusion A sgRNA incorporating... Return to SpCas9 plasmids GeCKO Library Genome-scale CRISPR-Cas9 knockout screening in human cells. Shalem...PubMed . Return to GeCKO Library SAM Library Genome-scale transcriptional activation by an engineered CRISPR-Cas9...
  16. TALEN Expression Vectors

    Type
    Collection
    ...methods yield TAL effector repeat arrays with identical DNA and amino acid sequences (i.e. only the details...vectors also have a FLAG epitope tag and nuclear localization signal at their amino-terminus. The expression...
  17. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic modifiers. Design your...and Interfere technologies also indirectly modify local chromatin state. Want more information on the wide...
  18. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Catalytically inactive CRISPR plasmids for purification of target loci....DNA-binding molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA...
  19. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...CRISPR-associated transposases (CASTs) combine the large-scale capacity of transposases (Tns) with the precise ...several separate Cas enzymes that form a complex called Cascade ( C RISPR- as sociated c omplex for a ntiviral...
  20. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Optogenetics Background In vivo imaging is a...interactions in deep-tissue organs and whole mammals. Genetically encoded fluorescent probes are suitable for stable...
Showing: 41 - 60 of 110 results