We narrowed to 63 results for: STO
-
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Empty gRNA expression vectors for insertion of custom gRNA target sequences...._LacZ 74293 Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes,... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Constitutive or Cre-dependent) Cell-specific restoration of stimulus preference after monocular deprivation...cpFRET kit from the Pertz laboratory to construct custom biosensors. The ScEnSor Kit from the Olsson laboratory... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...like GFP, researchers have turned dCas9 into a customizable DNA labeler compatible with fluorescence microscopy... -
DNA Service - Cloning Grade DNA
TypeCollection...resources you may find helpful. Our Scientific and Customer Support Teams are also available to provide assistance... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...possible to study the effect of the amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick... -
CRISPR Plasmids and Resources
TypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
CRISPR Plasmids - C. elegans
TypeCollection...Ingestion by C. elegans none, need Cas9 plasmid Ristow Do you have suggestions for other plasmids that... -
Recombinases AAV Preps
TypeCollection...Recombinases VCre AAV Browse the following tables for in-stock AAV preps that encode site-specific recombinases... -
Synthetic Biology - Overview
TypeCollection...Lei Stanley Qi Jeff Tabor Jan-Willem Veening Christopher Voigt Clifford Wang Ron Weiss Synthetic biology... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...Scar: ACCGGC Features: Modified RFC 10 w/ start and stop codons; Creates in-frame fusions w/ linker Thr-Gly... -
Promega Plasmid Collection
TypeCollection...visualization, and functional studies. You can even customize ligands for your specific purpose. HaloTag technology... -
Distribution to Industry
TypeCollection...SUMO Protease Elution Protein Characterization Christopher Bahl A validation set of 96 unique, single-domain... -
Plant Plasmids and Resources
TypeCollection...reproduces, and distributes diverse seed and other stocks of Arabidopsis thaliana and related species. The... -
Lentiviral Prep Service
TypeCollection...Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding... -
Fluorescent Protein Guide: FRET
TypeCollection...molecules or specific genes are also available. Custom biosensors can also be constructed using the cpFRET... -
Viral Vectors
TypeCollection... scientific review of our viral pages, we thank Boston Children's Hospital Viral Core . Viral Plasmid ... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection... novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of complete congenital... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...domain and the phosphosite, mCherry fluorescence is restored, so interactions can be discovered by fluorescence-activated... -
COVID-19 Resources
TypeCollection...Cytokines - SARS-CoV-2 infection induces a cytokine storm response in the body. For a full list of cytokines...