...tool to control neuronal activity, scientists generally attach a fluorescent protein to the opsin in order... of proteins can also be controlled by light, generally by utilizing a light sensitive protein from cryptochromes...used as an optical switch to control protein interactions, dimerization, localization or activity of many...

...Cas enzymes generate double strand breaks (DSBs). Nick Mutated Cas nickase enzymes generate single-strand...promoting DSB formation. Delete NEW Cascade-Cas3 generates large genomic deletions. Insert NEW CRISPR transposases...

...quality of research output, RESOLUTE expects to accelerate the pace of research in the field of SLCs to ... deorphanizing engine. Genetic and proteomic interactions represent the framework that provides biological.... Protein production is used for assays and to generate antibody/ high-affinity ligands. Data is embedded...

...England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids for visualization... is based on the human O6-alkylguanine-DNA-alkyltransferase (hAGT), a DNA repair protein, and is suitable...and the ACP and SFP Synthases. Users may still generate their own fluorescent or non-fluorescent CoA substrates...

...Resources for Microbiology General CRISPR Resources Read our CRISPR Guide for a general introduction to CRISPR...by Microbe System Plasmids for Archaea Species Haloferax sp. Methanococcus maripaludis Methanothermobacter...

...phosphorylation and acetylation, which disrupt its interaction with negative regulators, increase its stability...specific relationship. The content for this page was generated with the help of . Return to top p53 Pathway -...inhibitor 1 Bax BCL2-associated X protein Bid BH3 interacting domain death agonist CASP3 Caspase 3, apoptosis-related...

...suitable for FRET experiments to measure protein interactions or conformation changes, as well as FRET standards...FRET is often used to study (1) protein-protein interactions where each protein is separately fused to a ...fluorescently tagged proteins to study protein-protein interactions and a series of FRET standards . Pre-constructed...

...Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson 105536 ...control AAV that express fluorescent proteins under general promoters. These AAV can be used to compare the...

...Joung Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These...entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna...Dicot Plants Plant PCR-based procedure to rapidly generate multiple sgRNA expression cassettes, which can...

...lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...

...research. This collection is part of Addgene's Neurodegeneration Research Collection , which includes other...Research Tools Labs affiliated with MJFF have also generated a number of Shared Research Tools (Link opens ...

...blog post for more information. Empty Backbones mEmeralds Reds Blues Cyans Oranges Greens Yellows Photoactivatables... Empty Backbones Plasmid Description Industry mEmeralds Plasmid Description Industry Reds Plasmid Description...

...window) Researchers developing novel diagnostics, therapeutics, and vaccines against COVID-19 all rely on DNA...researchers to express SARS-CoV-2 viral proteins in several expression systems. Addgene has partnered with ...

...CRISPR nickase plasmids for the generation of single-strand breaks....entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna...

...and Libraries for Cancer Research Broad Target Accelerator Plasmids: Collection of vectors from the Boehm...mutant alleles described in the initial Target Accelerator publications, focused on somatic variants found...

...mammalian systems, Cas13a does not exhibit the collateral RNA degradation seen in bacteria. Want more information...entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna...

...sorting process. This combination allows IPI to generate antibodies to highly conserved proteins and other... with a mission to advance protein science to accelerate research and improve human health. As part of...

...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus... Neuroendocrine Tumor Research Foundation Neurodegeneration Research Collection Rett Syndrome Plasmid ...

...deletions generated by Cas9, large deletions created using Cas3 have fewer off-target alterations and require...

...reporter) pX458 plasmid family. They have made several modifications to the the pX458 plasmid to expand...Cloning Protocols Single guide cloning: Zhang Lab General Cloning Protocol (PDF, 237 KB) Dual guide cloning...