We narrowed to 111 results for: Eras
-
TypeCollection...Resources for Microbiology General CRISPR Resources Read our CRISPR Guide for a general introduction to CRISPR...by Microbe System Plasmids for Archaea Species Haloferax sp. Methanococcus maripaludis Methanothermobacter...
-
Adeno-associated virus (AAV) Plasmids
TypeCollection...disease in humans. For these reasons, AAVs are generally contained at lower biosafety levels and elicit...plasmids that are useful to produce AAV. In order to generate infectious AAV particles, a helper plasmid (encoding...Mutations PI AAV Plasmids This table contains a general list of plasmids that encode the AAV genome (i.... -
p53 Pathway
TypeCollection...phosphorylation and acetylation, which disrupt its interaction with negative regulators, increase its stability...specific relationship. The content for this page was generated with the help of . Return to top p53 Pathway -...inhibitor 1 Bax BCL2-associated X protein Bid BH3 interacting domain death agonist CASP3 Caspase 3, apoptosis-related... -
Fluorescent Protein Guide: FRET
TypeCollection...suitable for FRET experiments to measure protein interactions or conformation changes, as well as FRET standards...FRET is often used to study (1) protein-protein interactions where each protein is separately fused to a ...fluorescently tagged proteins to study protein-protein interactions and a series of FRET standards . Pre-constructed... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Joung Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These...entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna...Dicot Plants Plant PCR-based procedure to rapidly generate multiple sgRNA expression cassettes, which can... -
Control AAV Preps
TypeCollection...Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson 105534 ...control AAV that express fluorescent proteins under general promoters. These AAV can be used to compare the... -
Validated gRNA Sequences
TypeCollection...lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...research. This collection is part of Addgene's Neurodegeneration Research Collection , which includes other...Research Tools Labs affiliated with MJFF have also generated a number of Shared Research Tools (Link opens ... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...blog post for more information. Empty Backbones mEmeralds Reds Blues Cyans Oranges Greens Yellows Photoactivatables... Empty Backbones Plasmid Description Industry mEmeralds Plasmid Description Industry Reds Plasmid Description... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...window) Researchers developing novel diagnostics, therapeutics, and vaccines against COVID-19 all rely on DNA...researchers to express SARS-CoV-2 viral proteins in several expression systems. Addgene has partnered with ... -
CRISPR Plasmids - Single-Strand Break (Nick)
TypeCollection...CRISPR nickase plasmids for the generation of single-strand breaks....entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna... -
Cancer Research Plasmids and Resources
TypeCollection...and Libraries for Cancer Research Broad Target Accelerator Plasmids: Collection of vectors from the Boehm...mutant alleles described in the initial Target Accelerator publications, focused on somatic variants found... -
CRISPR Plasmids - RNA Targeting
TypeCollection...mammalian systems, Cas13a does not exhibit the collateral RNA degradation seen in bacteria. Want more information...entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna... -
DNA Service - Cloning Grade DNA
TypeCollection...Standard Quality Control Plasmid verified by next generation sequencing Plasmids Available as Cloning Grade...the plasmid sequence has been validated by next generation sequencing. The DNA concentration and 260/280... -
Institute for Protein Innovation
TypeCollection...sorting process. This combination allows IPI to generate antibodies to highly conserved proteins and other... with a mission to advance protein science to accelerate research and improve human health. As part of... -
Plasmid Collections
TypeCollection...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus... Neuroendocrine Tumor Research Foundation Neurodegeneration Research Collection Rett Syndrome Plasmid ... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...deletions generated by Cas9, large deletions created using Cas3 have fewer off-target alterations and require... -
Brzezinski Lab CRISPR Collection
TypeCollection...reporter) pX458 plasmid family. They have made several modifications to the the pX458 plasmid to expand...Cloning Protocols Single guide cloning: Zhang Lab General Cloning Protocol (PDF, 237 KB) Dual guide cloning... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...which are shipped as bacterial stabs at room temperature. Individual plasmids can be ordered from each...following items will be shipped as stabs at room temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ... -
CRISPR Plasmids - Base Edit
TypeCollection...and adenine base editors (ABEs) — can be used to generate single base pair edits without double stranded...entries describing enzyme activity, experimental considerations, and more, created and maintained by the Doudna...