We narrowed to 115 results for: Cre
-
TypeCollection...each (these can be built into PCR primers when creating a new part, with an additional 5' clamping sequence...Features: Modified RFC 10 w/ start and stop codons; Creates in-frame fusions w/ linker Thr-Gly; Use N-parts...
-
Viral Vector Guides and Plasmids
TypeCollection...generate viral vectors for research and gene therapy. Created with BioRender.com. Wild-type viruses have one ...vehicles to deliver genetic cargo into cells. To create safe and effective viral vectors, wild-type viral... -
CRISPR Plasmids - Prime Edit
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...another round. Figure 1: Overview of prime editing. Created with BioRender.com. The original prime editing ... -
Microbiology Resources
TypeCollection...used to reconstitute self-replicating microbes or recreate the diseases they cause. The standard format for...system - Wittbrodt Lab MultiSite Gateway Kit : Creating three-part fusion proteins - Planas and Santalucia... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection... used in the creation of the hiPS cell lines The following plasmids can be used to create cell lines with... -
Lentiviral Prep Service
TypeCollection...Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes involved in specific... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also... -
Rett Syndrome
TypeCollection...available directly from the labs in which they were created. Find their contact information by following the... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
Genetic Code Expansion
TypeCollection...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ...to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church " 68306 C321.ΔA all... -
TREAT-AD Plasmid Collection
TypeCollection...validated resources for emerging targets in AD and creating high-quality, well-characterized lead molecules... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection... Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...backbone with different fluorescent tags for you to create fusion proteins with your gene of interest. Most... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors... -
MAPK Plasmids
TypeCollection... plasmid collection for community. If you have created plasmids containing MAPK and would like to add ... -
Zinc Finger Consortium: Nuclease Expression Vectors
TypeCollection...nucleases in different cell types. Zinc finger arrays created using ZFC reagents for either OPEN or modular assembly... -
Fluorescent Protein Guide
TypeCollection...community-editable database for fluorescent proteins created by Talley Lambert (Link opens in a new window) ... -
Cancer Research Plasmids and Resources
TypeCollection... Tackling Cancers’ Drug Resistance with a New Screening Kit (David Sabatini & Kris Wood) National Cancer... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...