We narrowed to 114 results for: Cre
-
TypeCollection...each (these can be built into PCR primers when creating a new part, with an additional 5' clamping sequence...Features: Modified RFC 10 w/ start and stop codons; Creates in-frame fusions w/ linker Thr-Gly; Use N-parts...
-
Viral Vector Guides and Plasmids
TypeCollection...generate viral vectors for research and gene therapy. Created with BioRender.com. Wild-type viruses have one ...vehicles to deliver genetic cargo into cells. To create safe and effective viral vectors, wild-type viral... -
CRISPR Plasmids - Prime Edit
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...another round. Figure 1: Overview of prime editing. Created with BioRender.com. The original prime editing ... -
Microbiology Resources
TypeCollection...used to reconstitute self-replicating microbes or recreate the diseases they cause. The standard format for...system - Wittbrodt Lab MultiSite Gateway Kit : Creating three-part fusion proteins - Planas and Santalucia... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection... used in the creation of the hiPS cell lines The following plasmids can be used to create cell lines with... -
Lentiviral Prep Service
TypeCollection...Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes involved in specific... -
Fluorescent Protein Guide: FRET
TypeCollection...Addgene has a collection of plasmids suitable for creating individual fluorescently tagged proteins to study... for FRET The following plasmids can be used to create a fluorescent fusion protein with your gene of ... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also... -
Rett Syndrome
TypeCollection...available directly from the labs in which they were created. Find their contact information by following the... -
Genetic Code Expansion
TypeCollection...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ...to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church 68306 C321.ΔA all ... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
TREAT-AD Plasmid Collection
TypeCollection...validated resources for emerging targets in AD and creating high-quality, well-characterized lead molecules... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection... Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...backbone with different fluorescent tags for you to create fusion proteins with your gene of interest. Please... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors... -
MAPK Plasmids
TypeCollection... plasmid collection for community. If you have created plasmids containing MAPK and would like to add ... -
Zinc Finger Consortium: Nuclease Expression Vectors
TypeCollection...nucleases in different cell types. Zinc finger arrays created using ZFC reagents for either OPEN or modular assembly... -
Cancer Research Plasmids and Resources
TypeCollection... Tackling Cancers’ Drug Resistance with a New Screening Kit (David Sabatini & Kris Wood) National Cancer... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...