We narrowed to 113 results for: Cre
-
TypeCollection...at the central position. Introducing Hi-P for screening phosphorylation-dependent protein-protein interactions...domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The Mode #1 phosphosite library can also...
-
Rett Syndrome
TypeCollection...available directly from the labs in which they were created. Find their contact information by following the... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
Genetic Code Expansion
TypeCollection...cells. Many of these sets have been mutated and screened through directed evolution to charge the tRNA ...to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church 68306 C321.ΔA all ... -
TREAT-AD Plasmid Collection
TypeCollection...validated resources for emerging targets in AD and creating high-quality, well-characterized lead molecules... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection... Plasmids The following plasmids can be used to create cell lines with endogenously-tagged gene variants... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...backbone with different fluorescent tags for you to create fusion proteins with your gene of interest. Most... -
CRISPR Plasmids - RNA Editing
TypeCollection...adenosine deaminase to catalytically dead Cas13b creates a programmable RNA editor that converts adenosine... -
Depositor Collections
TypeCollection...Rinehart FreeGenes Project Open Enzyme Collection Screening Multiplexed Overexpression of Regulatory Factors... -
MAPK Plasmids
TypeCollection... plasmid collection for community. If you have created plasmids containing MAPK and would like to add ... -
Fluorescent Protein Guide
TypeCollection...community-editable database for fluorescent proteins created by Talley Lambert. Nikon MicroscopyU (Link opens... -
Zinc Finger Consortium: Nuclease Expression Vectors
TypeCollection...nucleases in different cell types. Zinc finger arrays created using ZFC reagents for either OPEN or modular assembly... -
Cancer Research Plasmids and Resources
TypeCollection... Tackling Cancers’ Drug Resistance with a New Screening Kit (David Sabatini & Kris Wood) National Cancer... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection... of purification of genomic loci using CRISPR. Created with BioRender.com. Browse, sort, or search the... -
CRISPR Plasmids - Xenopus
TypeCollection...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Overview of visualizing genomic loci using CRISPR. Created with BioRender.com. Browse, sort, or search the... -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection...Figure 1: Overview of the basic CAST mechanism. Created with BioRender.com. Browse, sort, or search the... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...plasmid in Addgene’s collection. These plasmids are created by your colleagues, sequence-verified, and widely... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...progression of the RNA polymerase, thus strongly decreasing the expression level. Mismatches between the ... -
Chemogenetics Plasmids
TypeCollection...PSEMs). PSAMs are coupled to an ion pore domain to create a ligand-gated ion channel. Whether a PSAM is activating...