Skip to main content
Addgene

We narrowed to 38 results for: Ank;

Showing: 1 - 20 of 38 results
  1. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Anti-Ankyrin-B [N105/13R] Ankyrin-B Human Mouse IgG2a 177494 Anti-Ankyrin-B [N105/17R] Ankyrin-B Human...Rat Mouse IgG2a 188222 Anti-Shank1 and Shank3 [N367/51R] Shank1 and Shank3 Rat Mouse IgG2a 188223 Anti-Synaptotagmin...Mouse IgG2a 222158 Shank1 [N22/18R] Shank1 Rat Mouse IgG2a 222159 Shank2 [N23B/9R] Shank2 Rat Mouse IgG2a...206727 Shank3 scFv [N69/46] N69/46 scFv Shank3 scaffold protein Rat Mouse 206728 Shank1 and Shank3 scFv ... Mouse 190523 Ankyrin-B scFv [N105/13] N105/13 scFv Ankyrin-B Human Mouse 190524 Ankyrin-B scFv [N105/... N105/17 scFv Ankyrin-B Human Mouse 190525 Ankyrin-G scFv [N106/20] N106/20 scFv Ankyrin-G Human Mouse...Mouse 190542 Pan-Shank scFv [N23B/49] N23B/49 scFv Pan-Shank Rat Mouse 190543 Shank2 scFv [N23B/6] N23B...
  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 76809 PANK2 gRNA (BRDN0001149459) PANK2 hU6 Hallervorden-Spatz disease David Root 76810 PANK2 gRNA (BRDN0001162474...BRDN0001162474) PANK2 hU6 Hallervorden-Spatz disease David Root 76811 PANK2 gRNA (BRDN0001162362) PANK2 hU6 Hallervorden-Spatz...LRRK2 Parkinson's William Hahn 23583 pDONR223-PANK2 PANK2 Hallervorden-Spatz disease William Hahn 23620...Hallervorden-Spatz disease David Root 76812 PANK2 gRNA (BRDN0001144887) PANK2 hU6 Hallervorden-Spatz disease David...Ac5 Parkinson's Elisa Izaurralde 79516 5E26 (PANK2) PANK2 His, TEV polH Hallervorden-Spatz disease Cheryl...OPTN_Halo_C_allele OPTN Halo ALS Michael Ward 178145 PANK2_Halo_C_allele PANK2 Halo Hallervorden-Spatz disease Michael...U6 Parkinson's Frank Soldner 180433 pU6-pegRNA-LRRK2-G2019S-3b LRRK2 U6 Parkinson's Frank Soldner 180434...
  3. Rett Syndrome

    Type
    Collection
    ... line repository Tissue Banks (Link opens in a new window) Harvard Brain Bank (Link opens in a new window...Autism Brain Bank (Link opens in a new window) University of Maryland Brain & Tissue Bank Antibodies (...Gribnau Xist 2lox/2lox Conditional Xist, Lox sites flanking exon 1,2,3 C57BL/6 Mouse line with conditional... (Link opens in a new window) PMID: 6638958 Kankirawatana et al. 2006. Early progressive encephalopathy...
  4. CRISPR Plasmids - Tagging

    Type
    Collection
    ...pFETCh_RERE PX458_RERE_1 RFXANK Human FLAG pFETCh_RFXANK PX458_RFXANK_1 PX458_RFXANK_2 RXRB Human FLAG pFETCh_RXRB... donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences and gRNA target sites...
  5. Cre-lox system

    Type
    Collection
    ...same cell type allows for recombination of LoxP flanked DNA sequences. Use the search box below to find...targeting vector with Cre FNF (neo-selectable marker flanked by FRT sites) Mammalian Mombaerts 15509 pBS-M71...vector with IRES CreFNF (neo-selectable marker flanked by FRT sites) Mammalian Mombaerts 17408 Puro.Cre...Cre-ERT2 Tamoxifen-inducible Cre None Zebrafish Stankunas 82696 pCRE-iRFP670 Cre and iRFP670 PGK Mammalian...Torok-Storb 99249 pVAX1/mTyr-Cre Cre Tyrosinase Mammalian Blank 101242 pSin wPGK-Cre low-efficiency Cre PGK Mammalian... either side of a gene (called “floxing”, for “flanked by loxP”), will permit gene expression until Cre...interest, removes Neo and stop cassette; Contains flanking arms for Rosa26 integration; See similar plasmid...
  6. Immunology Research Plasmids and Resources

    Type
    Collection
    ... expression) - RFXANK regulatory factor X-associated ankyrin-containing protein ANKRA1, BLS, F14150_1,...superfamily, member 11 CD254, ODF, OPGL, OPTB2, RANKL, TRANCE, hRANKL2, sOdf TNFSF12 tumor necrosis factor (ligand...CD265, FEO, LOH18CR1, ODFR, OFE, OPTB7, OSTS, PDB2, RANK, TRANCER TNFRSF11B tumor necrosis factor receptor...member 13b BAFF, BLYS, CD257, DTL, TALL-1, TALL1, THANK, TNFSF20, ZTNF4 TNFSF14 tumor necrosis factor (ligand...
  7. Antibody Guide

    Type
    Collection
    ...genetically engineered small proteins derived from ankyrin repeat proteins. These are antibody mimics instead...which controls for your antibody’s specificity. A blank (contains water or buffer instead of a biological...Visualization methods should employ positive, negative, and blank controls. Antibody Applications - Cell Sorting Methods...with only one antibody, for each antibody used. Blank controls in the form of sample buffer must also ...
  8. Luciferase Plasmid Collection

    Type
    Collection
    ...promoter for normalization. FMDV StopGo sequences flank the MCS for improved normalization. John Atkins ...expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo) Akaluc hPGK...expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian expression...
  9. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...dsDNA repair templates with homology to the DNA flanking the DSB and a specific edit close to the gRNA ...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing...
  10. CRISPR Guide

    Type
    Collection
    ...large scale edits by integrating segments of DNA flanked by specific repeat elements into the genome. CRISPR-associated.... J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson, J. W., Newby... PMID: 30323312 Yan, J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson...D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B., Kellner, M. J., Joung, J., & Zhang, F. (2017...
  11. Neurodegeneration Research Collection

    Type
    Collection
    ...channel [K55/7R] Anti-Fig4/Sac3 [N202/7R] Anti-Ankyrin-G [N106/36] Generate anti-kinesin recombinant scFvs...: Antibodies (Link opens in a new window) Brain Banks (Link opens in a new window) Rodent Models (Link...
  12. Plan Your Experiment

    Type
    Collection
    ...can locate potential PAM and target sequences and rank the associated gRNAs based on their predicted on-target...interest can be PCR amplified using primers that (A) flank the region of interest (deletions or small insertions...
  13. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...cells, Cas13-ADAR2 does not require a specific flanking sequence on the target RNA, making it a very flexible...rather than DNA, sometimes requiring a protospacer flanking sequence (PFS). In bacteria, Cas13 targeting also...
  14. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within 150 - 350 bp) to...This is a representative sequencing primer; other flanking primers may be utilized. Choose a sequence-verified...
  15. Validated gRNA Sequences

    Type
    Collection
    ...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our resources...
  16. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...RNA. dPspCas13b does not require a Protospacer Flanking Sequence (PFS), making it a very flexible editing...
Showing: 1 - 20 of 38 results