We narrowed to 14 results for: apoe
-
TypeCollection...pGL3Basic_ME.1/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter APOE ApoE Alzheimer's...190810 FUGW-APOE-E4-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190811 pTet-O-APOE-E2-T2A-Puro APOE UbC Alzheimer's... pTet-O-APOE-E3-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190813 pTet-O-APOE-E4-T2A-Puro APOE UbC Alzheimer's...190807 FUGW-APOE-E2-T2A-mCherry APOE mCherry UbC Alzheimer's Ronald Hart 190808 FUGW-APOE-E3-T2A-mCherry...T2A-mCherry APOE mCherry UbC Alzheimer's Ronald Hart 190809 FUGW-APOE-E4-T2A-mCherry APOE mCherry UbC Alzheimer's...41846 psiCheck-ApoE3'UTR APOE SV40 Alzheimer's Sohail Tavazoie 41848 psiCheck-ApoECDS APOE Luc SV40 Alzheimer's...Schwamborn 87085 pCMV4-ApoE2 APOE CMV Alzheimer's Bradley Hyman 87086 pCMV4-ApoE3 APOE CMV Alzheimer's Bradley...
-
Neurodegeneration Research Collection
TypeCollection...environmental factors. For example, variations of Apolipoprotein E (APOE), such as the ε4 allele, are a risk factor... -
Immunology Research Plasmids and Resources
TypeCollection...necrosis factor (ligand) superfamily, member 10 APO2L, Apo-2L, CD253, TL2, TRAIL TNFSF11 tumor necrosis ...necrosis factor (ligand) superfamily, member 10 APO2L, Apo-2L, CD253, TL2, TRAIL TYROBP TYRO protein tyrosine... necrosis factor receptor superfamily, member 25 APO-3, DDR3, DR3, LARD, TNFRSF12, TR3, TRAMP, WSL-1, ...Fas (TNF receptor superfamily, member 6) ALPS1A, APO-1, APT1, CD95, FAS1, FASTM, TNFRSF6 FASLG Fas ligand...involved in proliferation, cell differentiation, and apoptosis. Plasmid Tables The gene names in these tables... -
Cre-lox system
TypeCollection...tetracyclin-dependent transgene/shRNA expression ApoE.HCR.hAAT Mammalian Ehmer 85578 pTC-ApoE-Tet CreER expression and tetracyclin-dependent...tetracyclin-dependent transgene/shRNA expression ApoE.HCR.hAAT Mammalian Ehmer 85797 pSkipFlox split Cre Pfcrt... -
p53 Pathway
TypeCollection...agonist CASP3 Caspase 3, apoptosis-related cysteine peptidase CASP8 Caspase 8, apoptosis-related cysteine peptidase...effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in damaged cells. The p53 name ...oligomerization. In particular, the loss of p53’s pro-apoptotic effects is especially important to tumorigenesis... below. Symbol Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine...peptidase CASP9 Caspase 9, apoptosis-related cysteine peptidase Cyclin B CCNB1 CCNB2 CCNB3 Cyclin B1, ...protein p53 p53AIP1 Tumor protein p53 regulated apoptosis inducing protein 1 p53R2 p53 inducible, ribonucleotide...activator inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA apoa4 TAL3022 & TAL3025 TGGCAGGACCAACCAATGcccagcatggacctggTGAAAAATGCTTTCTGGA apoa4-like TAL3023...TGAAGGTTCTTGTGGTGCtcacacttgctgtggtTACAGGTAAGAAACTAAA apoeb TAL3402 & TAL3403 TGCCAGGCTCGTAGCCTGttccaggctgatgccccTCAGCCCAGATGGGAGGA... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...OZ528 OPEN OPEN cACCCTCCTCgtggtGCTGGTGGCc apoeb (apolipoprotein Eb) OZ529 and OZ530 OPEN OPEN gCCCCTCAGCccagatgGGAGGAGATg... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...A, Sanchez REA, Sedeno-Cortes A, Sevigny JP, Shapovalova N, Shulga L, Sigler AR, Siverts LA, Somasundaram...Radaelli C, Gore BB, Weed N, Omstead V, Bishaw Y, Shapovalova NV, Martinez RA, Fong O, Yao S, Mortrud M, Chong... -
CRISPR Plasmids - Base Edit
TypeCollection...dead” Cas9 (dCas9) to a cytidine deaminase like APOBEC. Base editors are targeted to a specific locus ... -
mTOR Pathway
TypeCollection...the presence of both pro-proliferative and anti-apoptotic signals. mTORC2, which appears to signal upstream... -
CRISPR Pooled gRNA Libraries
TypeCollection...tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV) Cow ( B... -
Validated gRNA Sequences
TypeCollection...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes... -
Trimmer Lab NeuroMab Collection
TypeCollection...IgG2a 188214 Anti-GST [N100/13R ] GST Schistosoma japonicum Mouse IgG2a 188215 Anti-TrpC7 [N64A/36R ] TrpC7...GST scFv [N100/13] N100/13 scFv GST Schistosoma japonicum Mouse 190522 Aldh1L1 scFv [N103/31] N103/31 scFv... -
CRISPR Guide
TypeCollection...nickase (Cas9n) or dCas9 to a cytidine deaminase like APOBEC. Within the region of single-stranded DNA created...