...in plants Myc Epitope tag pKMyc - N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial...Bacterial vector for Myc tag pETcon(-) - Yeast surface display vector with a C-terminal Myc tag pPMW-attB - pUASp... with N-terminal Myc tag and attB for Drosophila transgenesis His Epitope tag pEZYmyc-His - C-terminal...fusion protein. Read more about epitope tags and protein tags . Tag or Fusion Protein Common uses...collection page Return to top Epitope Tag or Fusion Protein Tags and fusion proteins are excellent tools...stop codon for C-terminal tags and omit the start codon for N-terminal tags. And when you are designing... C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG tag in pCS for ...

...Human Fluorescent-tagged EBNA1-mediated expression of human Oct3/4, shp53, Klf4, Sox2, L-Myc, Lin28 from separate...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency... be used to create cell lines with endogenously-tagged gene variants or browse Addgene’s entire collection...Lentivirus Human Expression of human Oct4, Sox2, Klf4, Myc, and Brd3R from five separate lentiviral plasmids...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible... the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under...vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming...

...-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson...pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5 WT Early endosomes RAB5A DsRed2...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization... NLS mKalama1 Robert Campbell 73205 pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3 Nucleus NLS (from Mak16p protein)...

...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...ataxia Ronald Kahn 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald Kahn 11487 pET32a-HD16Q...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...

... mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5)...pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Resources Read Addgene's Blog...

...NanoLuc® with either SNAP‐tag or HaloTag7 tag in which labeling of the self‐labeling tag with a fluorophore ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...and Renilla luciferase are less-than-ideal protein tags due to their large size. NanoLuc® Luciferase is ...biosensor that utilizes Renilla luciferase and a Halo tag to assay mRNA decay in real time. pKC-4.04, pKC-4.06...Lentiviral expression of firefly luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression...including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen ...

...collections: Tags and Other Markers : Antibodies targeting popular markers like tubulin or epitope tags like ...like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins for neuroscience research. Institute...

...Knock-in tagging - Michel Bagnat lab. Targeting cassettes encoding fluorescent proteins for tagging genes...bearing either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9...rapidly model potential cancer drivers in vivo. Biotagging toolkit - Tatjana Sauka-Spengler Lab. A genetic...

...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion...hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR Cre, KASH-tagged EGFP, and sgRNA expression hSyn AAV Zhang 60820...73472 RabV CVS-N2c(deltaG)-mCherry-P2A-Cre Cre CMV RABV Jessell 73474 RabV CVS-N2c(deltaG)-Cre Cre CMV RABV...Simpson 106368 pCMV-Tag2B-NCre N-terminal split-Cre CMV Mammalian Hirrlinger 106369 pCMV-Tag3B-CCre C-terminal...106370 pCMV-Tag2B-NCreERT2 N-terminal split-Cre-ERT2 CMV Mammalian Hirrlinger 106371 pCMV-Tag3B-ERT2CCre ...homology arms Mammalian Heller 113837 pCAGGS-mTagBFP2-T2A-iCre TagBFP, iCre CAG Mammalian Capecchi 113849 pCAGGS-pac-T2A-iCre...

... Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition...

...can be found in Botman et al., 2019 . FP Tagging Yeast tagging vectors to create fusions of proteins of...Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast. 2004 Jun;21(8):661-...plasmids to overexpress various fluorescent markers and tag your proteins of interest with fluorescent proteins...Materials Fluorescent Protein Plasmids & Resources FP Tagging FP Overexpression Resources This comprehensive ...allows for constitutive overexpression of FPs and tagging of genes of interest with FPs in yeast. Characterization...TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication FP Overexpression Plasmids for constitutive...Improved blue, green, and red fluorescent protein tagging vectors for S. cerevisiae. PLoS One. 2013 Jul 2...

...vector with the puromycin resistance gene 63591 3xFN-Tel-TAL/pMXs-neo Expresses a 3xFLAG-tagged TAL protein...Fujii, 2013). In iChIP, specific genomic regions tagged with the recognition sequences of an exogenous ...Fig. 1). In enChIP, specific genomic regions are tagged with engineered DNA-binding molecules such as TAL... 63589 3xFN-Tel-TAL/pCMV-7.1 Expresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat 63590...63590 3xFN-Tel-TAL/pMXs-puro Expresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat. A retroviral...systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 ...repeat. A retroviral expression vector with the neomycin resistance gene 64325 3xFLAG-dCas9/p-bacteria ...

...cloned into an IPTG-inducible His-tag expression vector. All His-tags are cloned at the C-terminus of ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular biology...a TEV cleavage site is present between the 6xHis-tag and the coding region of MDH. For detailed clone ...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic...

...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity...non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive...dependent 8 Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...fluoresce) Cre dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes 45186 AAV-...

...Includes tagging with CFP, YFP, and mRFP Tsoulfas Lab Lentiviral Plasmids - Fluorescently tag your gene...empty plasmid backbones with different fluorescent tags for you to create fusion proteins with your gene... iRFP Gradia Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab ...C. elegans Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95... expression Yeast Thorn Lab Vectors - Includes tagging with a wide variety of colors, some specifically...Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia...

...cassette in format: PGK-rtTA-2A-puro; see article for tagged insert options rtTA On Root 11651 pLVUT-tTR-KRAB...controls expression of gene of interest with Strep-Tag and Tet-On 3G transactivator, creating an auto-regulated...inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin selection TetR On Wiederschain...On System In 1995, Gossen et al. used random mutagenesis to identify which amino acid residues of tetR...from pCW57.1. rtTA was replaced with tTA, and Puromycin was replaced with Blasticidin selection. Please...

... (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope tags or fluorescent...include mutations seen in human patients, protein tags, or loxP/FRT sites, among others. Homology-directed... not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also be used to purify a genomic locus... EM, Myers RM. 2015. CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res . ...and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and...

...GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914...

... Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs...an anti-FLAG antibody to immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9...

...KB Fujii iChIP/enChIP to purify genomic DNA FLAG tagged dCas9 PDF 107.4 KB Goldstein Nematode: gRNA design...PDF 106.7 KB Mendenhall & Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor ; additional HDR... and quantify the efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can ...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...