Skip to main content
Addgene
Showing: 1 - 12 of 12 results

  1. p53 Pathway

    Type
    Collection
    ...48kDa p53 Tumor protein p53 p53AIP1 Tumor protein p53 regulated apoptosis inducing protein 1 p53R2 p53 ...Ras pathway Background p53 Pathway Plasmids p53 Gene List References Background p53 is a transcription factor...Addgene's collection of plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor... Cancer Research p53 Pathway p53 Pathway You May Also Like: Cancer Pathway ORF... list of p53 transcriptional targets is ever-expanding; the best-characterized effects of p53 are in promoting...effect on functional p53 through oligomerization. In particular, the loss of p53’s pro-apoptotic effects...the mechanisms by which mutant p53 is known to function in cancer. p53 Pathway Plasmids Click on a name...

  2. Cancer Research Plasmids and Resources

    Type
    Collection
    ...essential for regulating the growth of the cell. p53 p53, the most frequently mutated gene in human cancer...and Root labs for characterization of all possible p53 mutations. Resources New Tool for Lineage Tracing...expression vectors for in vitro and in vivo research. TP53 Mutagenesis Library : Pooled library from the Hahn...

  3. mTOR Pathway

    Type
    Collection
    ...mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53 PDK1 Pyruvate dehydrogenase kinase, isozyme...May Also Like: Cancer Pathway ORF Kit Ras Pathway p53 Pathway Tackling Cancers’ Drug Resistance with a ...dysregulated in cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple...

  4. Zhang Lab CRISPR Page

    Type
    Collection
    ... cancer modeling 60224 : sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, ... . simultaneously modeled the dynamics of KRAS , p53 and LKB1 , the top three significantly mutated genes...the lung generated loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated...described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...recombinase and sgRNAs targeting the mouse genes: Kras , p53 , and Lkb1 . This plasmid also contains a Kras G12D...

  5. Ras Pathway

    Type
    Collection
    ...T-cell lymphoma invasion and metastasis TP53 Tumor protein p53 TSC TSC1 TSC2 Tuberous sclerosis VAV1 Vav...Like: Ras Pathway Clone Collection 2.0 mTOR Pathway p53 Pathway Background Ras Pathway Plasmids Ras Gene ...

  6. Plasmids for Stem Cell Research

    Type
    Collection
    ...of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53 for single plasmid reprogramming Novel codon-optimized...Sox2, KLF4, L-Myc, Lin28, OCT3/4, and shRNA against p53 in different gene/insert combinations A more efficient...Fluorescent-tagged EBNA1-mediated expression of human Oct3/4, shp53, Klf4, Sox2, L-Myc, Lin28 from separate non-integrating...

  7. Luciferase Plasmid Collection

    Type
    Collection
    ...transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen Venken...

  8. Validated gRNA Sequences

    Type
    Collection
    ...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article 60224...GTCAATTGTTCTCTTTCTAT 64331 cut S. pyogenes 25281382 Jin Trp53 M. musculus CCTCGAGCTCCCTCTGAGCC 59910 cut S. pyogenes...

  9. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...] NPY Human Mouse IgG2a 177462 Anti-IRSp53/BAIAP2 [L117/1R] IRSp53/BAIAP2 Human Mouse IgG2a 177463 Anti-VGAT...channel Rat Mouse IgG2a 188156 Anti-IRSp53/BAIAP2 [L117/52R] IRSp53/BAIAP2 Human Mouse IgG2a 188157 Anti-Homer1... Parvalbumin Rat Mouse 182075 IRSp53/BAIAP2 scFv [L117/1] L117/1 IRSp53/BAIAP2 Human Mouse 182077 Calretinin...Neuropeptide Y Human Mouse 190506 IRSp53/BAIAP2 scFv [L117/1] L117/1 scFv 2t IRSp53/BAIAP2 Human Mouse 190507 ...Mouse Llama 135227 IC65 pEGFPN1 anti-IRSp53 nanobody IC65 IRSp53 Mouse Llama 135228 SS80 pEGFPN1 anti-...

  10. Distribution to Industry

    Type
    Collection
    ...Libraries Pooled Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe...Cas9-mediated saturation genome editing of human TP53 exon 5–8. Phagemid Synuclein VHH Immune Library ...

  11. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...89640 Knockout Human Wei 3rd Varies 12,472 pairs HR700_TP53 Exon Mutation Libraries 229137–229140 Donor Vector...

  12. Immunology Research Plasmids and Resources

    Type
    Collection
    ...SALPR SAA1 serum amyloid A1 MGC111216, PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond...S1P2 SAA1 serum amyloid A1 MGC111216, PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond...
Showing: 1 - 12 of 12 results