Skip to main content

We narrowed to 12 results for: Pol;

Showing: 1 - 12 of 12 results
  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...integration. Wildtype gamma-retroviruses contain the gag , pol , and env genes necessary for gamma-retroviral production...gamma-retroviral vectors use the common packaging genes gag , pol , and env . The LTRs flank all of these required ...Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; ...lines have been engineered to stably express gag-pol and/or env , eliminating the need to deliver these... Nolan at Stanford. These cell lines contain gag-pol and either an ecotropic envelope, Phoenix-ECO (for.... Another variant, Phoenix-gp, contains only gag-pol and enables additional flexibility in pseudotyping...usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins at the beginning...
  2. Lentiviral Vector Guide

    Type
    Guide
    ... plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding rev.... All retroviruses use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into...wild-type LTRs Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env All...chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid...promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins, by definition...containing matrix, capsid, and nucleocapsid components. pol in trans Precursor protein containing reverse transcriptase...
  3. Promoters

    Type
    Guide
    ...they control the binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive... and contains the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to this...systems Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes... is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during ...
  4. Sequencing Primers

    Type
    Guide
    ...vector Forward Polyhedrin forward AAATGATAACCATCTCGC Polyhedrin promoter Forward Polyhedrin reverse GTCCAAGTTTCCCTG...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end...DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...GTCCAAGTTTCCCTG For baculovirus vector with polyhedrin promoter Reverse pQE promoter CCCGAAAAGTGCCACCTG ...promoter Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon...
  5. Molecular Cloning Techniques

    Type
    Guide
    ...exonuclease activity of T4 DNA polymerase. In LIC, the T4 DNA polymerase’s exonuclease activity creates ...and thymine (T). TOPO cloning utilizes the Taq polymerase, which naturally leaves a single A overhang on...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase, and ligase. In Gibson assembly, DNA fragments...each other due to their homology. Second, DNA polymerase then closes the gap created by the 5’ exonuclease...reaction. In the presence of a single free dNTP, T4 polymerase will continue to function as an exonuclease until...complementary to the free nucleotide. T4 will resume its polymerase activity, add back the free base, and become ...
  6. Antibody Guide

    Type
    Guide
    ...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...
  7. Optogenetics Guide

    Type
    Guide
    ...optogenetics tool. They typically allow the fast depolarization of neurons upon exposure to light through direct...and traffics well to the membrane. Excitatory (Depolarizing) ChR Variants The optogenetic toolbox has been...light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements include..., Chrimson, ChrimsonR, Chronos Inhibitory (Hyperpolarizing) ChR Variants Alternatively, ChR variants that...chloride channels, these variants result in the hyperpolarization of neurons. Examples of anion channel variants...NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition) of the cell when triggered with... a light-activated outward proton pump that hyperpolarizes (inhibits) the cell when triggered by green-yellow...
  8. Molecular Biology Reference

    Type
    Guide
    ... DNA polymerase then binds to the single strand of DNA. Using this as a template, the polymerase migrates... requires the four nucleotides (dNTPs), a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro, you...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...increased nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear...vector capsid. Icosahedral Having the shape of a polyhedron with 20 faces, each being an equilateral triangle...
  10. Modular Cloning Guide

    Type
    Guide
    ...with up to eight transcription units. Yarrowia lipolytica Golden Gate tool kit Yeast Expression Tristan...transcription units in the oleaginous yeast Y. lipolytica . EXPRESSYALI Yeast Expression Irina Borodina...multi-gene constructs for integration into Y. lipolytica chromosomal loci. Yeast GPCR-sensor Toolkit Yeast...
  11. Adenovirus Guide

    Type
    Guide
    ...vector capsid. Icosahedral Having the shape of a polyhedron with 20 faces, each being an equilateral triangle...
  12. CRISPR Guide

    Type
    Guide
    ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...
Showing: 1 - 12 of 12 results