Skip to main content

We narrowed to 16 results for: Sele

Showing: 1 - 16 of 16 results
  1. Guide to Using Pooled Libraries

    Type
    Guide
    ...Apply selection, most cells die or do not pass selection (in the case of a reporter) Sort selected cells...employ a selection method relevant to the phenotype being studied. An example of a published selection mechanism...Sequence those cells that are selected Get a list of genes involved in the selection In a positive screen, the...goal is to identify cells that survive selection. The selective pressure must be strong enough that most...library Perform NGS on a control sample (no selection) Apply selection; most cells will survive Perform NGS ...survive the selection mechanism. You’ll transduce two sets of cells and subject one set to selection while ...identify which library elements are affected by selection, access to this technology is essential for any...
  2. Plan Your Experiment

    Type
    Guide
    ...Experiment Introduction Select Genetic Manipulation Design and Clone gRNA Select Expression and Delivery...expression vectors . Select Your Expression and Delivery System Once you have selected your target and designed... to plan a basic CRISPR experiment, including selecting the edit type, designing and cloning a gRNA, delivering... CRISPR experiment. Created with BioRender.com. Select Your Desired Genetic Manipulation Different genetic...manipulations require different CRISPR components. Selecting the genetic manipulation you plan to perform will... in mind when designing and cloning your gRNAs. Select Genetic Element to be Targeted The exact region...of your protein expressed in your system. HDR : Select a cut site as close as possible to the location...
  3. Molecular Biology Reference

    Type
    Guide
    ...out our promoters reference page . Selectable Marker Used to select for cells that have successfully taken...different than selecting for bacterial cells that have taken up the plasmid. The selectable marker is typically...the plasmid within bacteria, while allowing for selection against any bacteria not carrying the plasmid....bacteria. Antibiotic Resistance Gene Allows for selection of plasmid-containing bacteria by providing a ...-bacterial promoter or a fluorescent protein to select or sort the cells by visualization or flow cytometry...Regardless of type, plasmids are generally propagated, selected for, and their integrity verified prior to use...StrR) endA1 nupG Common Antibiotics for Plasmid Selection Each bacterium can contain multiple copies of ...
  4. Addgene's eBook Collection

    Type
    Guide
    ...Addgene's eBooks are here to help! 0 of 0 Selected Download Select Plasmids 101 September 2023 | Fourth...promoters and cloning techniques! Close About Overlay Select CRISPR 101 January 2021 | Third Edition About...libraries in genome-wide screens. Close About Overlay Select Fluorescent Proteins 101 August 2017 | First...fluorophores; and much more! Close About Overlay Select Viral Vectors 101 July 2024 | Second Edition...production and use, and much more! Close About Overlay Select Science Career Guide November 2018 | First ...the job application process. Close About Overlay Select CRISPR 101 en español January 2024 | First ...libro electrónico, CRISPR 101. Close About Overlay Select Antibodies 101 New! October 2024 | First Edition...
  5. Antibody Guide

    Type
    Guide
    ...nuclei, AF488, AF555, and AF647 Antibody Selection Selecting the right antibody for your experiment is...section to help you select antibodies for your approach. Primary antibodies To select an antibody, first...Methods Cell Sorting Methods Multiplex Assays Selection Validation Affinity reagents are molecular tools...mid-forties. When designing a multiplex assay, selection of the fluorophores used is important. It is best...appropriate lasers and filters for each fluorophore you select. Suggested panels for small multiplex experiments... you may either purchase several to compare, or select one based on price, shipping availability, ease... called secondaries, are usually much easier to select. There are three main considerations. What is the...
  6. Chemogenetics Guide

    Type
    Guide
    ...manipulation of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs...specific small molecules termed Pharmacologically Selective Effector Molecules (PSEMs). PSAM domains were ...domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows for the...-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding of the cognate PSEM allows for influx... & Roth, B. L. (2013). A Gαs DREADD Mouse for Selective Modulation of cAMP Production in Striatopallidal.... (2011). Chemical and genetic engineering of selective ion channel-ligand interactions. Science, 333 ..., T. (2020). Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...lentiviral vectors. Many gamma-retroviral vectors have selectable markers, such as the puromycin resistance gene... Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells...& Burgess, S. M. (2014). MLV integration site selection is driven by strong enhancers and active promoters...
  8. CRISPR Guide

    Type
    Guide
    ... complex functions, including the ability to selectively activate/repress target genes, purify specific...additional Cas proteins and PAM sequences . Once you’ve selected your target, you’ll express your gRNA and Cas9...There are many online tools available to help you select an optimized gRNA for your application (see: gRNA...is generally low (< 10% of modified alleles). Selecting a target cut site as close as possible to the ...design for CRISPR libraries is usually optimized to select for gRNAs with high on-target activity and low ... available in two formats: as liquid DNA, or in select cases, as pre-made lentivirus . DNA libraries are...
  9. Lentiviral Vector Guide

    Type
    Guide
    ... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...a host’s genome. Many lentiviral vectors have selectable markers, such as the puromycin resistance gene... Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells...
  10. Optogenetics Guide

    Type
    Guide
    ... and other limitations like bleaching. A more selective way to stimulate the activity of a particular ...photocurrent amplitude 467 Aurora Red-shifted anion-selective ReaChR variant; increased photocurrent amplitude...
  11. Educational Resources

    Type
    Guide
    ...include: Antibiotic Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information...
  12. Science Guides

    Type
    Guide
    ...that uses genetically engineered receptors to selectively control and investigate cell signaling pathways...
  13. Sequencing Primers

    Type
    Guide
    ...pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...
  14. Molecular Cloning Techniques

    Type
    Guide
    ...destination vectors with different promoters, tags, selection markers, and fluorescent proteins to fit a variety...
  15. Modular Cloning Guide

    Type
    Guide
    ...plasmids, including origins of replication and selection markers for a variety of bacterial and fungal ...
  16. Adenovirus Guide

    Type
    Guide
    ...replication-competent adenoviral vectors that can selectively infect, divide in, and lyse tumor cells. Viral...
Showing: 1 - 16 of 16 results