Skip to main content
Addgene

We narrowed to 16 results for: Sele

Showing: 1 - 16 of 16 results
  1. Guide to Using Pooled Libraries

    Type
    Guide
    ...employ a selection method relevant to the phenotype being studied. Examples of published selection mechanisms...screen: Apply library Apply selection Most cells die or do not pass selection (in the case of a reporter...on a control sample (no selection) In parallel, apply library Apply selection; most cells will survive...identify those cells that survive post-selection. The selective pressure must be strong enough that most...survive the selection mechanism. You’ll infect two sets of cells and subject one set to selection while the...evaluate which library components are influenced by selection, so it’s essential that you have access to this...pass (“win”) Get a list of genes involved in the selection NEGATIVE screen: Apply library Perform Next Generation...
  2. Plan Your Experiment

    Type
    Guide
    ...Experiment Introduction Select Genetic Manipulation Design and Clone gRNA Select Expression and Delivery...expression vectors . Select Your Expression and Delivery System Once you have selected your target and designed... to plan a basic CRISPR experiment, including selecting the edit type, designing and cloning a gRNA, delivering... CRISPR experiment. Created with BioRender.com. Select Your Desired Genetic Manipulation Different genetic...manipulations require different CRISPR components. Selecting the genetic manipulation you plan to perform will... in mind when designing and cloning your gRNAs. Select Genetic Element to be Targeted The exact region...of your protein expressed in your system. HDR : Select a cut site as close as possible to the location...
  3. Molecular Biology Reference

    Type
    Guide
    ...promoters reference page . Selectable Marker The selectable marker is used to select for cells that have successfully... the purpose of replication. The selectable marker enables selection of a population of cells that have...plasmids Antibiotics commonly used for plasmid selection DNA sequencing for plasmid verification Resources...the plasmid within bacteria, while allowing for selection against any bacteria not carrying the plasmid....to use. Antibiotic Resistance Gene Allows for selection of plasmid-containing bacteria by providing a ...and out-populate bacteria with plasmids, thus selecting against the propagation of these plasmids through...ampicillin. Under these conditions, there is a selective pressure to retain the plasmid DNA, despite the...
  4. Addgene's eBook Collection

    Type
    Guide
    ...Addgene's eBooks are here to help! 0 of 0 Selected Download Select Plasmids 101 September 2023 | Fourth...promoters and cloning techniques! Close About Overlay Select CRISPR 101 January 2021 | Third Edition About...libraries in genome-wide screens. Close About Overlay Select Fluorescent Proteins 101 August 2017 | First...fluorophores; and much more! Close About Overlay Select Viral Vectors 101 July 2024 | Second Edition...production and use, and much more! Close About Overlay Select Science Career Guide November 2018 | First ...the job application process. Close About Overlay Select CRISPR 101 en español January 2024 | First ...libro electrónico, CRISPR 101. Close About Overlay Select Antibodies 101 New! October 2024 | First Edition...
  5. Antibody Guide

    Type
    Guide
    ...nuclei, AF488, AF555, and AF647 Antibody Selection Selecting the right antibody for your experiment is...section to help you select antibodies for your approach. Primary antibodies To select an antibody, first...Methods Cell Sorting Methods Multiplex Assays Selection Validation Affinity reagents are molecular tools...mid-forties. When designing a multiplex assay, selection of the fluorophores used is important. It is best...appropriate lasers and filters for each fluorophore you select. Suggested panels for small multiplex experiments... you may either purchase several to compare, or select one based on price, shipping availability, ease... called secondaries, are usually much easier to select. There are three main considerations. What is the...
  6. Chemogenetics Guide

    Type
    Guide
    ...manipulation of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs...specific small molecules termed Pharmacologically Selective Effector Molecules (PSEMs). PSAM domains were ...domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows for the...-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding of the cognate PSEM allows for influx...Calakos N, Roth BL (2012). A Gαs DREADD Mouse for Selective Modulation of cAMP Production in Striatopallidal...SM (2011). Chemical and genetic engineering of selective ion channel-ligand interactions. Science. 333:...Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...lentiviral vectors. Many gamma-retroviral vectors have selectable markers, such as the puromycin resistance gene... Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells...& Burgess, S. M. (2014). MLV integration site selection is driven by strong enhancers and active promoters...
  8. CRISPR Guide

    Type
    Guide
    ... complex functions, including the ability to selectively activate/repress target genes, purify specific...additional Cas proteins and PAM sequences . Once you’ve selected your target, you’ll express your gRNA and Cas9...There are many online tools available to help you select an optimized gRNA for your application (see: Plan...is generally low (< 10% of modified alleles). Selecting a target cut site as close as possible to the ...design for CRISPR libraries is usually optimized to select for gRNAs with high on-target activity and low ... available in two formats: as liquid DNA, or in select cases, as pre-made lentivirus . DNA libraries are...
  9. Lentiviral Vector Guide

    Type
    Guide
    ... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...a host’s genome. Many lentiviral vectors have selectable markers, such as the puromycin resistance gene... Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells...
  10. Educational Resources

    Type
    Guide
    ...include: Antibiotic Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information...
  11. Science Guides

    Type
    Guide
    ...that uses genetically engineered receptors to selectively control and investigate cell signaling pathways...
  12. Sequencing Primers

    Type
    Guide
    ...pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...
  13. Cloning

    Type
    Guide
    ...of promoters and into backbones with different selection cassettes). Although gateway cloning is a simple...
  14. Modular Cloning Guide

    Type
    Guide
    ...plasmids, including origins of replication and selection markers for a variety of bacterial and fungal ...
  15. Optogenetics Guide

    Type
    Guide
    ...Blue-shifted iC++ variant 467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted...
  16. Adenovirus Guide

    Type
    Guide
    ...replication-competent adenoviral vectors that can selectively infect, divide in, and lyse tumor cells. Viral...
Showing: 1 - 16 of 16 results