Skip to main content

We narrowed to 15 results for: mal

Showing: 1 - 15 of 15 results
  1. CRISPR Guide

    Type
    Guide
    ...Browse Plasmids: Anti-CRISPR Small Precision Edits CRISPR can be used to make small, very precise edits of ... (dsDNA) plasmid. Small single-stranded DNA (ssDNA) oligos often work well for small edits like a single-point...Guide Jump To: CRISPR Guide Overview CRISPR Basics Small Edits Large Edits Genome-Wide Screening Cas9 Fusion...missing sequence, and is more commonly used for small precision edits. NHEJ directly ligates the break...efficient in repairing DSBs, it frequently causes small nucleotide insertions or deletions (indels) at the...modification ). In most cases, NHEJ gives rise to small indels in the target DNA that result in amino acid... handful of bases, or even a single base. These small precision edits can be done via HDR, base editing...
  2. Antibody Guide

    Type
    Guide
    ...methods: in animals, in cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies...Antibodies produced in animals make use of the animal’s immune system. The antigen of interest is introduced...introduced to the animal, which then mounts an immune response to it. Once the immune response has developed...antibody. Monocultures of B cells isolated from animals immunized as described above are used to create... protein chains: two large heavy chains and two small light chains. These four domains come together to...only produce one variable region. Isotypes The mammalian immune system produces five classes of antibodies...antibodies are typically collected directly from animals and contain antibodies targeting various epitopes...
  3. Promoters

    Type
    Guide
    ...transcription begins. Proximal Promoter Further upstream from the core promoter is the proximal promoter, which...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter...Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter...operon works in the opposite way. The operon is normally transcribed until a repressor/corepressor binds... a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). ...contains many primary regulatory elements. The proximal promoter is found approximately 250 base pairs... the distal promoter, which is upstream of the proximal promoter. The distal promoter also contains transcription...
  4. Molecular Biology Reference

    Type
    Guide
    ...molecules. To isolate a particular gene from human chromosomal DNA, it would be necessary to isolate a sequence...coined the term plasmid, in reference to any extrachromosomal heritable determinant. Plasmids are fragments...information and can replicate independently from chromosomal DNA. Although they can be found in archaea and...horizontal gene transfer called conjugation. Like chromosomal DNA, plasmid DNA is replicated upon cell division...variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid Elements...gene, origin of replication, and an MCS. They are small and optimized to help in the initial cloning of ...vectors can drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on...
  5. Modular Cloning Guide

    Type
    Guide
    ... Assembly into acceptor vectors. The Mammalian Toolkit Mammalian Expression Hana El-Samad 253 plasmids...MoClo-YTK . EMMA: Extensible Mammalian Modular Assembly Toolkit Mammalian Expression Yizhi Cai 95 plasmids...generate mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...homology domain, for mammalian or E. coli expression. T2A Split/Link TurboID Kit Mammalian Expression Sven ...constructs for integration into Y. lipolytica chromosomal loci. Yeast GPCR-sensor Toolkit Yeast Expression... Kit Bacterial Expression, Insect Expression, Mammalian Expression Stephan Gruber Platform for rapid assembly... Golden Gate-based cloning methods for use in mammalian cells. These can be used with plasmids from the...
  6. Plan Your Experiment

    Type
    Guide
    ...vector) is smaller than that of lentivirus. Thus, AAVs are generally only compatible with smaller Cas enzymes...focus on making single edits using CRISPR/Cas9 in mammalian cells as an example, but many of these principles...common categories of genetic manipulations used in mammalian cells and their corresponding Cas enzymes. In ...specific genomic edits, like point mutations or small tag insertions, by copying from a DNA donor template...exert their activity within a very narrow window proximal to the PAM sequence Base Edit Prime Edit Generate...KRAB can be more effective than dCas9 alone for mammalian cell lines Interfere Activate (CRISPRa) Increase... and base editor variants often have different optimal editing windows. Be sure to refer to the literature...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Adeno-Associated Viruses (AAV) are small, non-enveloped viruses containing a small, linear single-stranded DNA...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...limited by the physical space available inside of the small AAV capsid and directly correlates to the size of...molecular weight structures that are maintained extrachromosomally. Random integration of rAAV genomes in non-homologous...period of years without damaging the host cell. Episomal stability allows for long-term transgene expression... deliver genes to a wide range of tissues with minimal immune response, and the low risk of insertional...neural connections and brain structure due to their small size, low immunogenicity, and limited ability to...
  8. Chemogenetics Guide

    Type
    Guide
    ...can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic tools are...native ligands and are engineered to respond to small molecules that do not affect endogenous signaling...potency, which is potentially important for dosing in animal studies, made them attractive targets for development...muscarinic receptor. This DREADD was shown to have a small amount of constitutive activity, and is not widely...Compound 21. Both Compound 21 and DCZ seem to have minimal off-target activity, and do not seem to have the...receptor (nAChR) domains that respond to specific small molecules termed Pharmacologically Selective Effector...plasmids . Additionally, genetically engineered animal models expressing hM3Dq, hM4Di, and rM3D DREADDs...
  9. Adenovirus Guide

    Type
    Guide
    ...Instead, they remain as extrachromosomal elements within the nucleus, normally as double-stranded circular...cause a range of mild diseases in humans and other animals, most commonly respiratory infections, such as ...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...needs to be expressed by the packaging cell line, normally the human embryonic kidney 293 (HEK293) cell line...transgene expression delivered through rAdV vectors is normally transient and short-lived. Second- and third-generation...excellent vectors for delivering target antigens to mammalian hosts and have been used as vaccines against infectious...severity is increased with rAdV vectors as they are normally produced in high titers for their use in experiments...
  10. Molecular Cloning Techniques

    Type
    Guide
    ...BioRender.com. Gibson Assembly (Isothermal Assembly Reaction) Isothermal cloning, more commonly known as...their ends can be easily ligated together in one isothermal reaction. First, the 5’ exonuclease chews back...be transformed directly into E. coli , where the normal replication process will repair the nicks. It is...
  11. Guide to Using Pooled Libraries

    Type
    Guide
    ...plasmids in a single tube. Pooled libraries can be small, if they are designed to cover only a subset of ... their plasmids from the population, and only a small fraction survive. After the surviving cells are ... Company Resources Science Exchange Scientist (formally Assay Depot) Resources Find additional resources...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...envelope, Phoenix-AMPHO (for the infection of mammalian cells). Using this system, viral vectors are produced... G., Pond, S. M., Ferris, A. L., Hughes, S. H., Malech, H. L., & Wu, X. (2014). Enhancers are major targets...
  13. Optogenetics Guide

    Type
    Guide
    ... viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only in ...optically assembled protein architectures in living mammalian cells. LITE Two-hybrid system integrating the ...
  14. Science Guides

    Type
    Guide
    ...pathways. Receptors are remotely controlled via small molecules, which allows for specific control of ...
  15. Sequencing Primers

    Type
    Guide
    ...Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA...
Showing: 1 - 15 of 15 results