Skip to main content

We narrowed to 14 results for: plasmid dna

Showing: 1 - 14 of 14 results
  1. Molecular Biology Reference

    Type
    Guide
    ...Genetic Code Recombinant DNA Working with Plasmids Plasmid Elements Types of Plasmids Molecular Cloning Common... Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified viral genomes...transfer called conjugation. Like chromosomal DNA, plasmid DNA is replicated upon cell division, and each...fragments of DNA from one context to another, such as from a chromosome to a plasmid or vector DNA backbone...recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA fragment...fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used to study... structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which ...
  2. Molecular Cloning Techniques

    Type
    Guide
    ...ends in the DNA fragments. Given its prevalence, the vast majority of plasmids used for DNA cloning and...Addgene Blogs Plasmids 101: Restriction Cloning Plasmids 101: Gateway Cloning Plasmids 101: TOPO Cloning ...archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the DNA. In restriction cloning, scientists...any piece of DNA that already has restriction sites on either side of it into any plasmid that has the...method. During Gateway, moving a piece of DNA from one plasmid into another is done via a single recombination... approach, the fragment of DNA that you would like to clone into a plasmid must already be surrounded ... ends of the DNA sequence. This fragment can then be cloned into a Gateway donor plasmid, which contains...
  3. CRISPR Guide

    Type
    Guide
    ...-stranded DNA (dsDNA) plasmid. Small single-stranded DNA (ssDNA) oligos often work well for small edits...purify specific regions of DNA, image DNA in live cells, and precisely edit DNA and RNA. The ease of generating...Browse Plasmids: RNA Targeting , RNA Editing Degrading DNA with Cas3 Rather than initiating DNA cleavage...homology with the target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence...will begin to anneal to the target DNA. If the seed and target DNA sequences match, the gRNA will continue...strands of the target DNA. This results in a double-strand break (DSB) within the target DNA, located ∼3–4 nucleotides...of target DNA. Cas9n increases target specificity. Since two nickases targeting opposite DNA strands are...
  4. Promoters

    Type
    Guide
    ...Expression Plasmids 101: The Promoter Region — Let's Go! Plasmids 101: Inducible Promoters Plasmids 101: Repressible...binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ultimately translated...that the DNA tends to fold back on itself, which helps to explain how many physically distant DNA sequences...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last...Eukaryotic Promoters Resources A promoter is a region of DNA where transcription of a gene is initiated. Promoters...transcribed gene (Figure 1). The coding strand is the DNA strand that encodes codons and whose sequence corresponds...during transcription. Created with BioRender.com. DNA sequences called response elements are located within...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...different plasmid. In order to produce rAAV vectors, three plasmids are needed: Transfer plasmid (also known...the packaging plasmid. For a summary of all AAV plasmid components, see the AAV Plasmid Elements table...repeat DNA molecule that spontaneously reanneals upon infection, forming a double-stranded DNA (dsDNA) template...-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that...as cis plasmid) — containing the transgene of interest between the two ITRs. Packaging plasmid (also known...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...
  6. Adenovirus Guide

    Type
    Guide
    ...you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene...shuttle plasmid. For a summary of all adenoviral plasmid components, see the Adenoviral Plasmid Elements...for viral DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication...-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that...for recombination with the adenoviral plasmid. Adenoviral plasmid — containing the rest of the adenoviral...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...
  7. Modular Cloning Guide

    Type
    Guide
    ...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...for efficiently assembling multiple DNA parts into functional plasmids. It is a powerful and very efficient...recognition site, leaving DNA fragments with an overhang of 4 bp. If each DNA module is flanked with a ...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...
  8. Plan Your Experiment

    Type
    Guide
    ...generate stable cell lines if your plasmid contains a selection marker. Plasmid delivery is versatile thanks...more than just the DNA sequence. If this is the case, you can confirm your edit using DNA-based methods like...Application Cas Enzyme Additional Considerations Browse Plasmids Knockout Permanently disrupt gene function; cells...mutations or small tag insertions, by copying from a DNA donor template Cas9 or Cas9 fusions with proteins...different activator systems exist, including the multi-plasmid SAM system Activate Design and Clone Your gRNA ...efficiency . Remember that HDR also requires donor DNA to serve as template for the repair. Once you settle...settle on your gRNA, you can design a donor DNA to have the appropriate left and right homology arms. See...
  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gamma-Retroviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse... of all gamma-retroviral plasmid components, see the Gamma-Retroviral Plasmid Elements table . In order...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or ...capacity Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ... Science Guides Plasmid Pooled Libraries Guide to Plasmid Pooled Libraries Types of Libraries...consist of a single mixture of many different plasmids. Plasmids within a given library have the same backbone...addgene.org for assistance. For some libraries, plasmid DNA can be delivered directly to the cells of interest... others, notably pooled lentiviral plasmid libraries, the plasmids must first be used to make viral vectors...deliver the plasmids to the cells of interest. In either case, NGS of the amplified library DNA is recommended...transduced cell receives only one plasmid. To make sure that every plasmid is adequately represented in the... given plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library...
  11. Lentiviral Vector Guide

    Type
    Guide
    ...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — contains...Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains...systems Packaging Plasmid One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag...Lentiviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse...separated into distinct plasmids for safety. For a summary of all lentiviral plasmid components, see the ...four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest ...
  12. Antibody Guide

    Type
    Guide
    ...little variation. Recombinant plasmids - Antibodies can be produced from plasmids, with an antibody’s genetic... genes from specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced...interactions between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays... uses antibodies to capture protein:DNA complexes. After capture, the DNA is released from the complex...suitable for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ...immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals make...genetic code inserted into the plasmid. This produces the least amount of variation between antibodies, allows...
  13. Sequencing Primers

    Type
    Guide
    ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT...Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...
  14. Optogenetics Guide

    Type
    Guide
    ...Explore Addgene's Optogenetics Plasmid Collection to find the plasmids you need. Looking for viral preps...domain (iLID plasmid), while its natural binding partner SspB is included in a separate plasmid; Blue light...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin... learn more, or explore Addgene's Optogenetics Plasmid Collection . An optogenetics procedure. A channelrhodopsin...indicators or voltage sensors, visit our Biosensors Plasmid Collection . Microbial Opsins Opsins are light-...not exhaustive — please browse our Optogenetics Plasmid Collection to find the right tools for your experiments...ready-to-use AAV preparations of many optogenetics plasmids. Optical Switches Researchers have harnessed plant...
Showing: 1 - 14 of 14 results