Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 11 results for: tac promoter

Showing: 1 - 11 of 11 results

  1. Sequencing Primers

    Type
    Guide
    ...terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG (Waugh lab) Tac promoter, forward primer tdTomato-Fwd...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...

  2. Molecular Biology Reference

    Type
    Guide
    ...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region... of Replication Plasmids 101: The Promoter Region-Let’s Go Promoters Reference Page Plasmids 101: How ...

  3. Promoters

    Type
    Guide
    ...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...The Promoter Region-Let's Go Plasmids 101: Inducible Promoters Plasmids 101: Repressible Promoters Plasmids...

  4. Lentiviral Vector Guide

    Type
    Guide
    ...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... mitigated through the use of tissue-specific promoters and envelope genes, and/or with site-specific ...

  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks...

  6. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor...inhibition Tung et al., 2015 iLMO: GeNL_SS- hGtACR1 GeNL_SS hGtACR1 CFz Cl - influx Neuronal inhibition Ikefuama...

  7. Cloning

    Type
    Guide
    ...destination plasmids have been made with different promoters, tags and fluorescent proteins. Thus, you can ...different tags, putting it under a variety of promoters and into backbones with different selection cassettes...amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of DNA sequence. This fragment...

  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... proteins, often under strong neuron-specific promoters or neural Cre-dependent expression, to visualize...recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis...nuclear export of RNA and RNA translation, and promotes RNA transcript longevity. Located between WPRE...elements are needed. One strategy to overcome this obstacle, has been to use smaller Cas9 orthologs, such ...with most experiments, infection risks occur with contact to mucous membranes or broken skin. Needle sticks...

  9. CRISPR Guide

    Type
    Guide
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...

  10. Adenovirus Guide

    Type
    Guide
    ... Repeat, serve as self-priming structures that promote primase-independent DNA replication. 3' ITR (RITR... Repeat, serve as self-priming structures that promote primase-independent DNA replication. Homology arms...with most experiments, infection risks occur with contact to mucous membranes or broken skin. The risk of...

  11. Optogenetics Guide

    Type
    Guide
    ...expression of the opsin. Depending on the virus and promoter system used, there is an incubation time (days...channel variants from other species include: GtACR1 and GtACR2 (from the cryptophyte Guillardia theta ). ... mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia theta...that bind to the LOV domain only in the dark. attaching only one member of the Zdk/LOV2 pair to the target...
Showing: 1 - 11 of 11 results