Human CRISPR Metabolic Gene Knockout Library
(Pooled Library #110066, #110066-LV)

• Purpose:

  This lentiviral CRISPR library targets 2,981 human metabolic genes with 29,790 guide RNAs plus 500 intergenic controls. The library contains ~10 gRNAs per gene.

• Vector Backbone:

  lentiCRISPR v1 (Plasmid #49535) - expresses Cas9

  Note: This plasmid has been discontinued, as an updated version is available. For confirmation of screen hits, Addgene encourages recipient scientists to use the updated lentiCRISPR v2 (Plasmid #52961), which can be requested separately.

• Depositing Labs: David Sabatini
• Publication: Birsoy et al. Cell. 2015 Jul 30;162(3):540-51. doi: 10.1016/j.cell.2015.07.016.

Library Details

• Species: Human
• Genes targeted: 2,981
• Total gRNAs: 30,290
• Controls: 500 intergenic
• Lentiviral Generation: 3rd

Library Shipping

This library is delivered as suspended DNA in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

• Volume: ∼20 µL
• Concentration: 50 ng/µL

Resource Information

• Protocols:
  • Library Transformation Protocol (DOCX, 16 KB)
  • Library Screening Protocol (DOCX, 17 KB)
  • PCR Protocol for Illumina Sequencing Preparation (DOCX, 15 KB)
• Depositor Data:
  • List of Targeted Genes (XLSX, 65 KB)
  • List of gRNA Sequences (XLSX, 828 KB)
  • Distribution of NGS Reads (PDF, 9.3 KB)
• Articles Citing this Pooled Library:
  • Human CRISPR Metabolic Gene KO Library (#110066)

Terms and Licenses

Academic/Nonprofit Terms:

• UBMTA

Industry Terms:

• Not Available to Industry

Trademarks:

• Zeocin® is an InvivoGen trademark.

Depositor Comments

Figure 1: Overview of library screening process.

When performing sgRNA validation in a Cas9-expressing cell line, the depositing laboratory recommends using plasmid pLenti-sgRNA (Addgene #71409).

Information for Lentiviral Prep (Catalog # 110066-LV)

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Contains 29,790 gRNAs, targeting 2,981 genes. Lentiviral particles carrying human CRISPR metabolic gene knockout library in lentiCRISPR v1.

Delivery

• Volume: Varies depending on titer.
• Titer: ≥ 2 × 10⁶ TU/mL
• Storage: Store at -80 °C. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPRO SFM
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:

• To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:

• ddPCR: 293T cells are transduced with serial dilutions of 110066-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.

PCR confirmation of insert:

• PCR was carried out with primers targeting Cas9 and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
  • Forward primer: CCAAAGAGGTGCTGGACG

  • Reverse Primer: GCAGAATCCAGGTGGCAACA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.1 × 10⁸ infectious units are shipped on dry ice at a titer of ≥ 2 × 10⁶ TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Birsoy et al., 2015 ).

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

• This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Birsoy et al., 2015 ), perform screen analysis by determining the log₂-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 ).

• The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Transformation Protocol (DOCX, 16 KB) for more information.