-
PurposegRNA for csr-1 locus in N. crassa
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS426
- Total vector size (bp) 6274
-
Vector typeYeast Expression, CRISPR ; N. crassa, Fungi
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA for csr-1 locus
-
Alt namegRNA
-
Alt namecsr-1
-
gRNA/shRNA sequenceGAGTGGGAGGGTCCCGTCCT
-
SpeciesN. crassa, S.pyogenes, other fungi
- Promoter SNR52
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGAGCTTCTTTGAAAAGATAATGTATG
- 3′ sequencing primer GTTACATGCGTACACGCGTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byp426-SNR52p-gRNA.CAN1.Y-SUP4t (Plasmid #43803)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The target sequence to csr-1 locus was added instead of CAN1 of p426-SNR52p-gRNA.CAN1.Y-SUP4t (Plasmid #43803) from Dr. Church lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p426-SNR52p-gRNA.csr-1.Y-SUP4t was a gift from Christian Hong (Addgene plasmid # 68060 ; http://n2t.net/addgene:68060 ; RRID:Addgene_68060) -
For your References section:
Efficient gene editing in Neurospora crassa with CRISPR technology. Matsu-Ura T, Baek M, Kwon J, Hong C. Fungal Biol Biotechnol. 2015 Jul 15;2:4. doi: 10.1186/s40694-015-0015-1. eCollection 2015. 10.1186/s40694-015-0015-1 PubMed 28955455