-
PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiGuide-Puro
-
Backbone manufacturerFeng Zhang Lab
- Total vector size (bp) 10214
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-Puro-WPRE-hU6-gRNA
-
gRNA/shRNA sequencereplace filler with custom gRNA sequence or library
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGGCACTGACAATTCCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see CROP-seq supplementary website for protocols, data archives and related software at: http://www.medical-epigenomics.org/papers/datlinger2017/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-Guide-Puro was a gift from Christoph Bock (Addgene plasmid # 86708 ; http://n2t.net/addgene:86708 ; RRID:Addgene_86708) -
For your References section:
Pooled CRISPR screening with single-cell transcriptome readout. Datlinger P, Rendeiro AF, Schmidl C, Krausgruber T, Traxler P, Klughammer J, Schuster LC, Kuchler A, Alpar D, Bock C. Nat Methods. 2017 Jan 18. doi: 10.1038/nmeth.4177. 10.1038/nmeth.4177 PubMed 28099430