|
|
206788 |
Arx scFv [N411/51] |
Arx (Mus musculus) recombinant scFV (Mus musculus)
|
Trimmer |
Mar 25, 2024 |
|
|
216323 |
pAAV-CMV-BD10-SAS620-3’dCas9-VPR-synpA |
Split Cas9-VPR + splice acceptor site (Synthetic)
|
Becirovic |
Mar 25, 2024 |
|
|
216322 |
pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA |
Split Cas9-VPR + splice donor site + gRNAs targeting the murine Myo7b locus for transactivation (Synthetic)
|
Becirovic |
Mar 25, 2024 |
|
|
216321 |
pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA |
Split Luciferase + splice acceptor site (Synthetic)
|
Becirovic |
Mar 25, 2024 |
|
|
216320 |
pAAV-CMV-5'Luciferase(split CAGGT)_BDlacZ-SV40polyA |
Split Luciferase + splice donor site (Synthetic)
|
Becirovic |
Mar 25, 2024 |
|
|
214666 |
pAAV_MLP-BC0250-luc2 |
Adenovirus major late promoter (MLP) with barcode 0250 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
216319 |
pAAV2.1-CMV-BD lacZ_3' Cer-bGHpA |
Split Cerulean + splice acceptor site (Synthetic)
|
Becirovic |
Mar 25, 2024 |
|
|
216318 |
pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA |
split cerulean fluorescent protein + splice donor site (Synthetic)
|
Becirovic |
Mar 25, 2024 |
|
|
214667 |
pAAV_MLP-BC0252-luc2 |
Adenovirus major late promoter (MLP) with barcode 0252 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214670 |
pAAV_MLP-BC1405-luc2 |
Adenovirus major late promoter (MLP) with barcode 1405 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214669 |
pAAV_MLP-BC1403-luc2 |
Adenovirus major late promoter (MLP) with barcode 1403 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214668 |
pAAV_MLP-BC0253-luc2 |
Adenovirus major late promoter (MLP) with barcode 0253 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214649 |
pGL4_EGR1p-BC1485-luc2 |
EGR1 promoter with barcode 1485 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214634 |
pGL4_10xUAS-CMVmin-BC0427-luc2 |
10x clustered UAS element with barcode 0427 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214646 |
pGL4_EGR1p-BC0130-luc2 |
EGR1 promoter with barcode 0130 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214648 |
pGL4_EGR1p-BC0143-luc2 |
EGR1 promoter with barcode 0143 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214619 |
pGL4_10xUAS-CMVmin-BC0376-luc2 |
10x clustered UAS element with barcode 0376 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214620 |
pGL4_10xUAS-CMVmin-BC0382-luc2 |
10x clustered UAS element with barcode 0382 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214621 |
pGL4_10xUAS-CMVmin-BC0383-luc2 |
10x clustered UAS element with barcode 0383 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214622 |
pGL4_10xUAS-CMVmin-BC0385-luc2 |
10x clustered UAS element with barcode 0385 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214623 |
pGL4_10xUAS-CMVmin-BC0386-luc2 |
10x clustered UAS element with barcode 0386 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214637 |
pGL4_CRE-CMV-BC0484-luc2 |
6x clustered CRE element with barcode 0484 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214618 |
pGL4_10xUAS-CMVmin-BC0374-luc2 |
10x clustered UAS element with barcode 0374 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214659 |
pGL4_NFAT-RE-CMV-BC0529-luc2 |
6x clustered NFAT element with barcode 0529 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214662 |
pGL4_NFAT-RE-CMV-BC0537-luc2 |
6x clustered NFAT element with barcode 0537 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
214651 |
pGL4_EGR1p-BC1487-luc2 |
EGR1 promoter with barcode 1487 (Synthetic)
|
Wehr |
Mar 25, 2024 |
|
|
211115 |
pUC19-Top2A-5X Gly-Venus-T2A-Hygro |
5' C-term Top2A homology arm (Homo sapiens), Venus (Other), T2A (Synthetic), Blastocidin Resistance (Other), 5' C-term Top2A homology arm (Homo sapiens)
|
Dekker |
Mar 25, 2024 |
|
|
206980 |
SpIMPDH |
SpIMPDH (Other)
|
Schramm |
Mar 25, 2024 |
|
|
215624 |
pGal4-DBD-OCT4_AroPERFECT_N |
OCT4 AroPERFECT N (Homo sapiens)
|
Hnisz |
Mar 25, 2024 |
|
|
195560 |
pBaseline-PRM-wasabi |
mWasabi (Synthetic)
|
Shapiro |
Mar 25, 2024 |
|
|
195557 |
pTcI39-switch |
mRFP1 (Synthetic), mWasabi (Synthetic), TcI39 (Other)
|
Shapiro |
Mar 25, 2024 |
|
|
195555 |
pTcI39-PRM-wasabi |
mWasabi (Synthetic), TcI39 (Other)
|
Shapiro |
Mar 25, 2024 |
|
|
195554 |
pTcI38-PRM-wasabi |
mWasabi (Synthetic), TcI38 (Other)
|
Shapiro |
Mar 25, 2024 |
|
|
195553 |
pCIwt-PRM-Wasabi |
mWasabi (Synthetic), CIwt (Other)
|
Shapiro |
Mar 25, 2024 |
|
|
215691 |
pcDNAintron-LASV-GPC-HA-c3xFLAG |
LASV GP-HA-FLAG (Other)
|
Brindley |
Mar 25, 2024 |
|
|
215692 |
pcDNAintron-EBOV-GP |
EBOV-GP (Other)
|
Brindley |
Mar 25, 2024 |
|
|
215689 |
pcDNAintron-LASV-GPC-c3xFLAG |
LASV GP-FLAG (Other)
|
Brindley |
Mar 25, 2024 |
|
|
215693 |
pcDNAintron-XKR8-n3xFLAG |
XKR8-n3xFLAG (Homo sapiens)
|
Brindley |
Mar 25, 2024 |
|
|
215690 |
pcDNAintron-LASV-GPC |
LASV GP (Other)
|
Brindley |
Mar 25, 2024 |
|
|
215675 |
pMS18 |
eef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG (Caenorhabditis elegans)
|
Phillips |
Mar 25, 2024 |
|
|
215676 |
pMS62 |
eef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG (Caenorhabditis elegans)
|
Phillips |
Mar 25, 2024 |
|
|
215683 |
pMS161 |
U6p::GTCCAGCGGCAGATCGGCGG (Synthetic)
|
Phillips |
Mar 25, 2024 |
|
|
215674 |
pMS110 |
5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA (Caenorhabditis elegans)
|
Phillips |
Mar 25, 2024 |
|
|
204021 |
pUCmini-NFKB2-PGK-tdTomato |
tdTomato
|
Sato |
Mar 25, 2024 |
|
|
204020 |
pUCmini-NFKB2-PGK-EGFP |
EGFP
|
Sato |
Mar 25, 2024 |
|
|
204019 |
pUCmini-NFKB1-PGK-tdTomato |
tdTomato
|
Sato |
Mar 25, 2024 |
|
|
204018 |
pUCmini-NFKB1-PGK-EGFP |
EGFP
|
Sato |
Mar 25, 2024 |
|
|
193658 |
pCMV-RVR-A3A-Y130F |
RVR-dLbCas12a-hA3A-Y130F, EGFP (Synthetic)
|
Lai |
Mar 25, 2024 |
|
|
198339 |
PB-Ef1a-RPS27A-UTR-PP7-WPRE |
RPS27A-3'UTR-PP7 stem loops x24 (Homo sapiens)
|
Ward |
Mar 25, 2024 |
|
|
198338 |
PB-Ef1a-SunTag-RPS7-PP7-WPRE |
GCN4x24-RPS7-3'UTR-PP7 stem loops x24 (Homo sapiens)
|
Ward |
Mar 25, 2024 |