-
Plasmid#203817PurposeDNA donor for transposition, shuttle vector for Corynebacterium glutamicum / E. coliDepositorInsertMini-Tn, Spec cassette
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCgVchcrRNA
Plasmid#203815PurposeExpression of CRISPR RNA, shuttle vector for Corynebacterium glutamicum / E. coliDepositorInsertCRISPR(BsaI)
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD424
Plasmid#178202PurposeExpression of Rok from the hns promoterDepositorInsertphns + rok
UseTagsExpressionBacterialMutationPromoterhns promoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD410
Plasmid#178200PurposeExpression of sRok from the hns promoterDepositorInsertphns + srok
UseTagsExpressionBacterialMutationPromoterhns promoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-MBP-bhaB5
Plasmid#167812PurposeExpresses His6- and MBP-tagged BhaB5 in E. coliDepositorInsertBhaB5
UseTagsHis6, MBPExpressionBacterialMutationPromoterT7Available sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSunS 1-335
Plasmid#171673PurposeSunS 1-335 expression in E. coliDepositorInsertGlycosyltransferase SunS (sunS Bacillus subtilis (strain 168))
UseTagsHis-tagExpressionBacterialMutationPromoterT7Available sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT174_GalL_A3A-Y130F-BE3
Plasmid#145123PurposeExpressing base editor A3A-Y130F-BE3 in yeast cellsDepositorInsertA3A(Y130F)-BE3
UseCRISPRTagsExpressionYeastMutationA3A(Y130F); spCas9(D10A)PromoterGalLAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT173_GalL_A3A-R128A-BE3
Plasmid#145122PurposeExpressing base editor A3A-R128A-BE3 in yeast cellsDepositorInsertA3A(R128A)-BE3
UseCRISPRTagsExpressionYeastMutationA3A(R128A); spCas9(D10A)PromoterGalLAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJT113_GalL_cCDA1-xBE3
Plasmid#145079PurposeExpressing base editor cCDA1-xBE3 in yeast cellsDepositorInsertcCDA1-xBE3
UseCRISPRTagsExpressionYeastMutationspCas9(D10A, A262T, R324L, S409I, E480K, E543D, M…PromoterGalLAvailable sinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ291-D573A
Plasmid#129676PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b
UseCRISPR; Gateway compatible bthcas12b entry cloneTagsExpressionPlantMutationD573A; BthCas12b is rice codon optimizedPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ291-D951A
Plasmid#129677PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b
UseCRISPR; Gateway compatible bthcas12b entry cloneTagsExpressionPlantMutationD951A; BthCas12b is rice codon optimizedPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ291-E827A
Plasmid#129678PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b
UseCRISPR; Gateway compatible bthcas12b entry cloneTagsExpressionPlantMutationE827A; BthCas12b is rice codon optimizedPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m4
Plasmid#84723PurposepVR2 but with G to U and A to C mutations following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutationG to U mutation at the first nucleotide after the…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m5
Plasmid#84724PurposepVR2 but with an insertion of 1 U immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutationinsertion of 1 U between positions 39 and 40 of a…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m6
Plasmid#84725PurposepVR2 but with an insertion of 2 U's immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutationinsertion of 2 Us between positions 39 and 40 of …PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m7
Plasmid#84726PurposepVR2 but with a G to U mutation immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutationG to U mutation at position 41 of annotated "…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2-m8
Plasmid#84727PurposepVR2 but with two G to U mutations immediately following the riboswitch aptamerDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutationG to U mutations at positions 40 and 41 of annota…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVR2
Plasmid#84719PurposeE. coli RecA promoter followed by stretch with no A's followed by riboswitch for single-round transcriptionDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutation12 nt stretch lacking A's inserted before 5&…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1G108CFa
Plasmid#85089PurposeExpresses PCNA1 variant (G108C) fused to an FAD domain of P450 BM3 (A74G/C773S/C810S) in E. coliDepositorInsertThe G108C variant of PCNA1 fused to an FAD domain of P450 BM3
UseTagsHis6 tagExpressionBacterialMutationG108C in PCNA1, A74G/C773S/C810S in FAD domain of…PromoterT7 promoterAvailable sinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVRa31_34
Plasmid#49687DepositorInsertECF31_34
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable sinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRa30_35
Plasmid#49685DepositorInsertECF30_35
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable sinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRc31_34
Plasmid#49747DepositorInsertAS31_34
UseSynthetic BiologyTagsExpressionBacterialMutationCodon optimized for E.coliPromoterpLuxAvailable sinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRc30_35
Plasmid#49746DepositorInsertAS30_35
UseSynthetic BiologyTagsExpressionBacterialMutationCodon optimized for E.coliPromoterpLuxAvailable sinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAB051e
Plasmid#79195PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPExt-10cons lambda op-62 gIII, luxAB; Ptet lambda cI-SH2ABL1
UseTagsExpressionBacterialMutationPromoterPExt-10cons lambda op-62; PtetAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pAB078d7
Plasmid#79205PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPlacZ-opt (off-target) luxAB; Ppro1 434cI-SH2ABL1
UseTagsExpressionBacterialMutationPromoterPlacZ-opt (off-target); Ppro1Available sinceAvailabilityAcademic Institutions and Nonprofits only -
pAB085e
Plasmid#79212PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPlacZ-opt (OR1) luxAB; Ptet 434cI-TnTBR3-F7
UseTagsExpressionBacterialMutationPromoterPlacZ-opt (OR1); PtetAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-BSR-GFP11
Plasmid#68716PurposeSplit GFP assayDepositorInsertbsr
UseRetroviralTagsFLAG and GFP11ExpressionMammalianMutationPromoterAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSP6-RNAP
Plasmid#48143PurposeShuttle vector E. coli/B.meg.; encoding the RNA polymerase of the phage SP6 under control of the xylose inducible promoter PxylADepositorInsertrna polymerase SP6
UseSynthetic BiologyTagsExpressionBacterialMutationV314A (numbering based on NCBI Sequence ID: NP_85…PromoterAvailable sinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-mNaChBac-P2A-EGFP
Plasmid#176280PurposeViral vector for co-expression of NaChBac and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertmNaChBac-P2A-EGFP
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterhuman Synapsin IAvailable sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-soxA
Plasmid#190057PurposeExpress the bacterial monomeric sarcosine oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertSoxA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
UseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCgVchCAST-crtYf
Plasmid#203816PurposeExpression of CRISPR-associated transposases, shuttle vector for Corynebacterium glutamicum / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(crtYf)
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRTagsExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ291-D573A-SRDX
Plasmid#129683PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b-SRDX
UseCRISPR; Gateway compatible bthcas12b entry cloneTagsExpressionPlantMutationD573A; BthCas12b is rice codon optimizedPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3R112C/T180CHFm
Plasmid#85091PurposeExpresses PCNA3 variant (R112C/T180C) fused to heme-FMN domain of P450 BM3 variant (A74G) in E. coliDepositorInsertThe R112C/T180C variant of PCNA3 fused to Heme-FMN domain of P450 BM3
UseTagsHis6 tagExpressionBacterialMutationR112C/T180C in PCNA3, A74G in heme-FMN domain of …PromoterT7 promoterAvailable sinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOpen-Bstpol
Plasmid#165543PurposeFull length DNA polymerase from Bacillus stearothermophilus.DepositorInsertBst DNA Polymerase, Full Length
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 9, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCWori cytochrome P450-BM3h 9D7
Plasmid#61308PurposeExpresses Cytochrome P450-BM3h 9D7 with C-terminal 6-His tagDepositorInsertCytochrome P450-BM3 heme domain 9D7
UseTags6xHisExpressionBacterialMutationT268A, I263A, T438V, A328GPromoterTacAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRTagsExpressionBacterialMutationD10A, H840APromoterxylAAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only