We narrowed to 209 results for: fga
-
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTUU
Plasmid#159749PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pCEE
Plasmid#159746PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCUU
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HA-APP-mGFP
Plasmid#196696PurposeExpresses APP695 with an HA tag an N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsHA and mGFPExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
APP-bio-His
Plasmid#51643PurposeExpresses full-length Amyloid beta A4 protein precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertAPP (APP Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Human ABeta-attR5
Plasmid#160436PurposeEntry vector for cloning human Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorInsertAPP (APP Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human Wild-type ASAP1
Plasmid#235212PurposeExpresses Wild-Type ASAP1 in mammalian cellsDepositorInsertASAP1 (ASAP1 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APP-mGFP
Plasmid#196694PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmEGFP and mtagBFP2ExpressionMammalianMutationPromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APP-mGFP
Plasmid#196704PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmCherry and mEGFPExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APPP1-mGFP
Plasmid#196705PurposeAs mCherry-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmCherry and mEGFPExpressionMammalianMutationLys to Val substitution at position 612PromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APPP1-mGFP
Plasmid#196695PurposeAs mBFP-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmEGFP and mtagBFP2ExpressionMammalianMutationLys to Val substitution at position 612PromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorInsertAICD (APP Human)
UseAAVTagsExpressionMutationNonePromoterhuman synapsinAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsAP, Avitag and HAExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Zebrafish, Human)
UseZebrafish expressionTagsmCherryExpressionMutationPromoterCMVAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_LUP1
Plasmid#103857PurposeHeterologous, cobalt-inducible expression of SQE1 and LUP1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertlupeol synthase 1 (LUP1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorUseTags13xMyc, Flag, and HAExpressionMammalianMutationPromoterCMVAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only