We narrowed to 2,297 results for: dcas9
-
Plasmid#99866PurposeEncodes for Cas9-VP64, MS2-p65-HSF1, mCherry and for the gRNA 2.0DepositorInsertUniSAM-mCherry + U6-gRNA2.0
UseCRISPR and Synthetic Biology; Dcas9-sam activationExpressionMammalianMutationBbsI sites in CDS were ablated by consensus mutat…PromoterEF1aAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#106249PurposeLentiviral vector with puro selection for expression of S. aureus dCas9-KRABDepositorInsertdead S. aureus Cas9 KRAB T2A PuroR
UseCRISPR and LentiviralTagsHA-NLS and NLS-KRABExpressionMammalianMutationD10A and N580APromoterhUbCAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCBE4-gam
Plasmid#124449PurposeExpresses dead Cas9 (dCas9)-CBE4-gamDepositorInsertdCBE4-gam
UseCRISPR and Synthetic BiologyExpressionMammalianMutationD10A, H840AAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a-DNMT3l
Plasmid#154140PurposeExpresses the scFv-GCN4-DNMT3a-DNMT3l fusion protein (more details are shown in the vectro map) for targeted DNA methylation. Should be used in a combination with the dCas9-SunTag systems.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBTK615
Plasmid#110609PurposeBTK assembled plasmid - used in Stage 2 assembly to target Cas9 or dCas9DepositorInsertsgRNA
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79621PurposeExpresses dCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
TagsPmCDA1ExpressionMammalianMutationD10A and H840A for nuclease deficient Cas9PromoterpCMVAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC0.017
Plasmid#119621PurposeLevel 0 Part. CDSDepositorInsertdCas9
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0.018
Plasmid#119622PurposeLevel 0 Part. CDSDepositorInsertdCas9+deg-tag
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOG250
Plasmid#80582Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG251
Plasmid#80583Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG252
Plasmid#80584Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG253
Plasmid#80585Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only