We narrowed to 3,108 results for: dcas9
-
Plasmid#239939PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable sinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1019
Plasmid#239941PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyExpressionPlantMutationN/AAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cLYN268
Plasmid#188259PurposePlasmid ensures constitutive expression of the C-terminal fragment of split LYN kinase domain (aa 239-267), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable sinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP HAT
Plasmid#179547Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP HAT domain (aa 1323-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-GFP-gfp_pJMP2768
Plasmid#208889PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, gfp-targeting gRNA).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
ExpressionBacterialAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC1-pCR8-dCas9VP48
Plasmid#48214PurposedCas9VP48 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP48 activation domain
UseCRISPR and Gateway CloningTagsHA Tag and VP48MutationD10A;H840AAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSM-dCas9::Ap
Plasmid#154307PurposeShuttle vector for expression dCas9, mobilization cluster, expresses the tracrRNA and a CRISPR array designed for the easy cloning of new spacers.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR)
Plasmid#209775PurposeCRISPRi for STK3DepositorAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-dCas9-olEzh2(deltaSET)
Plasmid#180217PurposeEzh2 (delta SET domain) fused to dCas9 for H3K27me3 epigenome editing control.DepositorInsertenhancer of zeste 2 polycomb repressive complex 2 subunit (deltaSET)
TagsFLAG and dCas9ExpressionBacterialAvailable sinceFeb. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NONO2_IDR-EGFP
Plasmid#232765PurposeExpresses dCas9-NONO2_IDR-EGFPDepositorAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NONO1_IDR-EGFP
Plasmid#232764PurposeExpresses dCas9-NONO1_IDR-EGFPDepositorAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-hHDAC4-tagBFP-PGK-Blasticidin
Plasmid#187954PurposeFKBP12 (F36V mutant) degron-tagged dCas9-hHDAC4 fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-hHDAC4-tagBFP
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (1645/1646 RR/EE)
Plasmid#61359Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation 1645/1646 RR/EE) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, S. pyogenes, Human)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1645/1646 RR/EE m…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only