We narrowed to 7,281 results for: mCherry
-
Plasmid#241297PurposeMammalian expression of syntaxin-1(K84TAG) fused to mCherry for genetic code expansion via Amber codon supressionDepositorAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Syntaxin1A(E49TAG)-mCherry
Plasmid#241291PurposeMammalian expression of syntaxin-1(E49TAG) fused to mCherry for genetic code expansion via Amber codon supressionDepositorAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pyGAIP-LATeNT-mCherry
Plasmid#240976PurposeExpresses LATeNT-mCherry in yeast cytosolDepositorInsertLATeNT-mCherry
ExpressionYeastAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
EML6442_p35S-mCherry2-SV40
Plasmid#234351PurposeExpressed mCherry2 florescent proteins in plant cells for tracing transformation eventsDepositorInsertSpeR
ExpressionPlantAvailable SinceNov. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PhoCl AND A-SpyTag
Plasmid#246950PurposeExpresses multifunctional construct for AND-gated release of mCherry from materials in response to 405 nm light AND sortase eSrtA(2A9) treatment. Contains a SpyTag for material tethering.DepositorInsertPlease see depositor comments below
Tags6x His tag, SsrAExpressionBacterialAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
TPC2-D276K-mCherry
Plasmid#240469PurposeRed-tagged lysosomal channel (pore-dead)DepositorInsertTPC2N2 (TPCN2 Human)
TagsmCherryExpressionMammalianMutationMutated aspartate 276 to lysine.PromoterCMVAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry Rab2a Q41L
Plasmid#245029PurposeConstitutively active human Rab2a Q41L mutantDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2-mCherry sgmRELA_1
Plasmid#241447PurposeDelete mouse RelaDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-Mex3a-mCherry
Plasmid#241312PurposeExpression of Mex3a-mCherry fusion protein in mammalian cellsDepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Rubicon-CGHL
Plasmid#221658PurposeRubicon mutated at four residues in the RH domain to disrupt Rab7 binding, tagged at the N-terminus with mCherryDepositorInsertRUBCN (RUBCN Human)
TagsmCherryExpressionMammalianMutationC912G, C915G, H920L, C923GPromoterCMVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-NLS-mCherry(AM)
Plasmid#244814PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mCherry-labeled Nuclear Localization Signal (NLS) TagDepositorInsertmCherry
UseIn-vitro mrna synthesisTagsSV40 NLSMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-MEME-mCherry(AM)
Plasmid#244816PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mCherry-labeled GAP43 Membrane Anchor (MEME) TagDepositorInsertmCherry
UseIn-vitro mrna synthesisTagsGAP43 Membrane Anchor (MEME) TagMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-mCherry-CAAX
Plasmid#223674PurposeAAV expression of mCherry from hSyn1 promoterDepositorInsertmCherry-CAAX
UseAAVPromoterhSyn1Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV Protease-mCherry
Plasmid#243794PurposeEncodes for mammalian expression of TVMV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-mCherry GAC
Plasmid#227830PurposeTo amplify the virus that expresses C-mCherry GACDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1983 UbL40-mCherry
Plasmid#242440PurposeAe aegypti UbL40 promoter expressing mCherryDepositorInsertmCherry
ExpressionInsectAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48A)-mCherry
Plasmid#193635PurposeExpresses S48A phosphodead VAMP3 fused to mCherryDepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationchanged serine 48 to alaninePromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-RILPL1 (R293A)
Plasmid#244981PurposeExpress RILPL1 in mammalian cells with mCherry tag expressing a R293A mutationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only