We narrowed to 2,113 results for: 1186
-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pZE21/UBP1/ClpS
Plasmid#98566PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationIn a synthetic operon downstream of UBP1 and Remo…PromoterSame as UBP1 (operon) and Tet promoter (aTc induc…Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Synthetic, Mouse)
UseLentiviralTagsNLS-HAExpressionMammalianMutationPromoterhuman ubiquitin C promoterAvailable sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-Btl2
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
UseTagsExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMiR-E6AP-3'UTR-miR-375-mut
Plasmid#53695PurposeLuciferase reporter assay for E6AP 3'UTR with point mutation on miR-375 binding siteDepositorInsertUBE3A 3'UTR (UBE3A Human)
UseLuciferaseTagsExpressionMutationMutation on miR-375 binding site on E6AP 3'U…PromoterAvailable sinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/S647A
Plasmid#74938PurposeMammalian expression of human NSF mutant S647A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationS647A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43 (PY-NLS)
Plasmid#235490PurposeExpression of chimeric human TDP-43-EGFP bearing a PY-nuclear localization sequence (NLS) from HNRNPA1 in place of the native NLS sequenceDepositorInsertTARDBP (TARDBP Human)
UseTagsEGFPExpressionMammalianMutationReplaced native NLS with PY-NLS from HNRNPAPromoterAvailable sinceMay 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-SpCas9-HF1
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationPromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1b
Plasmid#176021PurposeLeishmania cell free expression of zebrafish EGFP-Bin1b. Parton lab clone GRSDepositorInsertBin1b (bin1b Zebrafish)
UseLeishmania cell free expressionTagsEGFPExpressionMutationPromoterAvailable sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianMutationPromoterEF-1α promoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only