We narrowed to 77,321 results for: ANG
-
Plasmid#84590PurposeRenilla Luciferase reporter assay for TOB1 3'UTR with mutations on miR-200c binding siteDepositorInsertTOB1 3'UTR (UTS2R Human)
UseLuciferaseTagsRenilla LuciferaseMutationMutation on miR-200c binding site on TOB1 3'…PromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-RanBP93'UTR-mir200c-mut
Plasmid#84592PurposeRenilla Luciferase reporter assay for RANBP9 3'UTR with mutations on miR-200c binding siteDepositorInsertRANBP9 3'UTR (RANBP9 Human)
UseLuciferaseTagsRenilla LuciferaseMutationMutation on miR-200c binding site on RANBP9 3…PromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1m
Plasmid#123308PurposeExpresses the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based NE sensor GRAB_NE1m
UseAAVMutationcontains a glycine-to-threonine mutation at posit…PromoterhSynAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NE1h
Plasmid#123309PurposeExpresses the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based NE sensor GRAB_NE1h
UseAAVPromoterhSynAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NEmut
Plasmid#123310PurposeExpresses the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based NE control sensor GRAB_NEmut
UseAAVPromoterhSynAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for calcium ion
Plasmid#60887PurposeFPX biosensorDepositorInsertsingle polypeptide FPX biosensor for calcium ion
TagsHindIII siteExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
BNLS
Plasmid#50836PurposeExpresses a tandem ddFP heterodimer in mammalian cells, construct 1 for a translocation-based green fluorescent caspase-3 biosensor, used together with plasmid 1 (GANLS-DEVD-BNES or RANLS-DEVD-BNES).DepositorInsertddGFP B
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
GANLS
Plasmid#50852PurposeExpresses one ddFP in mammalian cells, the second plasmid for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with plasmid NESRA-DEVD-BNLS.DepositorInsertddGFP A
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
RANLS
Plasmid#50843PurposeExpresses one ddFP in mammalian cells, the second plasmid for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with plasmid GANES-DEVD-BNLS.DepositorInsertddRFP A
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for caspase-1
Plasmid#60885PurposeFPX biosensor for caspase-1DepositorInsertsingle polypeptide FPX biosensor for caspase-1
TagsHindIII site and NES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for caspase-8
Plasmid#60884PurposeFPX biosensor for caspase-8DepositorInsertsingle polypeptide FPX biosensor for caspase-8
TagsHindIII site and NES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
hCEP120-Myc
Plasmid#50381PurposeTet-On inducible expression of Myc-tagged hCEP120DepositorInsertHuman CEP120 (CEP120 Human)
TagsMycExpressionMammalianMutationThis hCEP120 contains 4 SNPs (rs6876883, rs659544…PromoterCMV-2xTetOAvailable SinceJuly 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for both caspase-3 and -8
Plasmid#60886PurposeFPX biosensorDepositorInsertsingle polypeptide FPX biosensor for caspase-3 and 8
TagsHindIII site and NES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-KLF9 3'UTR
Plasmid#84599PurposeRenilla luciferase reporter containing KLF9 3'UTRDepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-K27M-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131462PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A K27M, PDGFRA D842V, and TRP53DepositorInsertH3F3A-K27M-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A K27M, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131461PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of WT H3F3A and oncogenic PDGFRA D842V and TRP53DepositorInsertH3F3A-WT-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationPdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor-H3F3A-G34R-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
Plasmid#131463PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic H3F3A G34R, PDGFRA D842V, and TRP53DepositorInsertH3F3A-G34R-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTrp53-V5, H3F3A-EGFP-AU1ExpressionMammalianMutationH3F3A G34R, Pdgfra D842VPromoternone (4x polyA to mitigate episomal expression)Available SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12VWPRE
Plasmid#129420PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusionDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Entacmaea quadricolor (TagBFP), Human)
UseMosaic analysis for dual recombinase-mediated cas…TagsTagBFP2-V5 tagMutationG12VPromoternone (3x polyA to mitigate episomal expression)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
ppyCAG_RNaseH1_D210N
Plasmid#111904PurposeExpress D210N mutated RNASEH1 which abolishes the catalytic activity of RNASEH1DepositorAvailable SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only