We narrowed to 2,297 results for: dcas9
-
Plasmid#119279Purposefor stabilizing ICE in the presence of rapI expressionDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1171
Plasmid#119253Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1161
Plasmid#119251Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1219
Plasmid#119259Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-C-intein-C-spC9-H840A-N863A-2xNLS-hGH
Plasmid#112211PurposeTargeted DNA methylationDepositorInsertC-terminus of dCas9
UseAAVMutationD10AAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE2
Plasmid#120396PurposeExpresses HF2-BE2 in mammalian cellsDepositorInsertHF2-BE2
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-1-6
Plasmid#227487Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-6-11
Plasmid#227488Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA033
Plasmid#216013PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-NG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA035
Plasmid#216015PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpRY_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA034
Plasmid#216014PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR
Plasmid#215377PurposeLentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control.DepositorInsertmNeonGreen-3K-1-10
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only