We narrowed to 5,634 results for: chia
-
Plasmid#131311PurposeCMV promoter expression plasmid for bpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (ABEmax with truncation of WT TadA domain).DepositorInsertbpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-EcSTH-FLAG
Plasmid#218628PurposeThis plasmid contains human codon optimized sequence of EcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertEcSTH
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD)
Plasmid#204619PurposeExpression vector of Cascade and Cas3. Puromycin selectable.DepositorInsertCas7, Cas5, Cas8, Cas11, Cas6, and Cas3
UseCRISPRTagsEach protein has C- and N-terminal SV40 NLSExpressionMutationPromoterEF1aAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-mitoEcSTH-FLAG
Plasmid#218629PurposeThis plasmid contains human codon optimized sequence of mitoEcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertmitoEcSTH
UseLentiviral and Synthetic BiologyTagsFLAG and MTSExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-recA56
Plasmid#89962PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
UseTagsExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTet and proDAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
UseTags6xHis Tag and TEV Cleavage SiteExpressionBacterialMutationPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB
Plasmid#162572PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency.DepositorInsertsLambda Red-Beta
E. coli SSB
UseTagsExpressionBacterialMutationPromoterpBADAvailable sinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Thy1StTA
Plasmid#97411PurposeTET driver for amplified expression in cortical neuronsDepositorInserttTA
UseAAVTagsExpressionMammalianMutationPromotermouse thy1PSsAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC1_oROS-HT
Plasmid#216413PurposeExpresses the genetically encoded, chemigenetic hydrogen peroxide sensor oROS-HT in mamalian cells.DepositorInsertoROS-HT
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-PTuner DD-M.EcoGII-v5-Telomeric repeat-binding-factor1
Plasmid#122084PurposeExpress M.EcoGII fused to TRF1 with detabilization domain - inducibleDepositorInsertDD-linker-M.EcoGII-V5-TERF1
UseRetroviralTagsV5 tag on Nter of TERF1ExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
RGB-S reporter
Plasmid#207841PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coliDepositorInsertsRpoH sensing construct
SOS sensing construct
RpoS sensing construct
UseTagsExpressionBacterialMutationPromoterPosmY, PsulA, and grpEAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HisMBP-SED1
Plasmid#178191PurposeSED1 biosensor for expression in Escherichia coliDepositorInsertSED1 biosensor
UseTags6xHis-MBPExpressionBacterialMutationPromotertacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
UseTags6XHis, EGFP, and FlagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMM643
Plasmid#112533PurposepZE2-PLhrtO-lux-hrtR-RBS3-chuA - HrtR RBS variant of plasmid pMM627 (Strength 33545.5 AU), ColE1 origin, KanRDepositorInsertsHrtR
ChuA
luxCDABE
UseTagsExpressionBacterialMutationA17PPromoterJ23107, PL(HrtO), and ProDAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPing
Plasmid#47100PurposeExpresses the Ping open reading frame 1 (ORF1) and transposase from rice to allow mPing movement. The vector contains ORF1, transposase, mPing element and hph for hygromycin selection.DepositorInsertsPing cDNA
mPing
hygromycin resistance gene
UsePlant expressionTagsGFPExpressionYeastMutationPromoterCaMV35s and StUbi3Available sinceSept. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
p-spTorA-GFP-H6C
Plasmid#168517PurposeGFP with the signal peptide of TorA (spTorA) in pBAD24. Includes a C-terminal HHHHHHC (6xHisC) extension.DepositorInsertspTorA-GFP-H6C
UseTags6xHisC tag and spTorA (signal peptide of E. coli …ExpressionBacterialMutationThe mut3 GFP variant with 5 additional mutations …PromoteraraBADAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
ScSpe1 pET-20b(+)
Plasmid#117145PurposeExpresses the His tagged Saccharomyces cerevisiae Ornithine Decarboxylase in Escherichia coli BL21DepositorInsertSPE1
UseTagsHistidineExpressionBacterialMutationPromoterT7Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT-YFP-TetR
Plasmid#59018PurposeExpresses a fusion of yellow fluorescent protein (YFP) to the N-terminus of the Escherichia coli Tn10 tet repressor (TetR) driven by the alpha tubulin promoter for use in T. gondiiDepositorInsertYFP-TetR
UseToxoplasma expressionTagsExpressionMutationPromoteralpha-tubulinAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCK301
Plasmid#87767PurposeE. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest to express using L-rhamnose, three terminators, ampR, pBR322 origin, lacIDepositorInsertPrhaBAD-sfGFP
UseSynthetic BiologyTags6xHis TagExpressionBacterialMutationPromoterPrhaBAD rhamnose-inducible promoter from E. coliAvailable sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHS0766 pET45b(+) His14-MBP-TEV-AloTnpB-2 3' extension
Plasmid#176542PurposeBacterial expression of His14-MBP-TEV-AloTnpB-2 with 3' extension derived from locusDepositorInsertsMBP tag
TnpB
UseTags3' extension derived from endogenous locus a…ExpressionBacterialMutationPromoterAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAd5-Blue
Plasmid#174431PurposepAd5-Blue provides a platform for the rapid construction of recombinant and replication defective Adenovirus. This vector contains unique restriction enzyme sites to allow cloning of a gene.DepositorInsertβ-galactosidase α gene fragment
UseAdenoviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICSL11055
Plasmid#68252PurposeLevel 1 Golden Gate Cassette: Plant kanamycin resistance cassetteDepositorInsertPromoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos
UseSynthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceSept. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK314
Plasmid#110545PurposeModified (delta CRP-binding site) rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteriaDepositorInsertsModified PrhaBAD (CRP-binding sites removed)
yfp
rhaS
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_EF1_AnapRS
Plasmid#174894PurposeAnapRS expression for amber suppression in mammalian cells; transient or piggy bac mediated integrationDepositorInsertAnapRS
UseTagsExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-LplA(AAG)
Plasmid#61307PurposeContains FLAG epitope for immunofluorescence detection of resorufin ligase for mammalian cell expressionDepositorInsertE. coli lipoic acid ligase
UseTags6xHis, Flag, T7 tag, and Xpress epitopeExpressionMammalianMutationE20A, F147A, H149GPromoterCMVAvailable sinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRD395
Plasmid#163102PurposeExpression of mCherry_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmCherry_H-NSdbd
UseTagsExpressionBacterialMutationPromoteraraBAD promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-TetR
Plasmid#103813PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1Tt
Plasmid#44509DepositorInsertsUseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET22b-ecDHFR-N23PP/L28F/G51PEKN
Plasmid#118585PurposeBacterial expression of E.coli DHFR N23PP, L28F, and G51PEKN mutantDepositorInsertDHFR
UseTagsExpressionBacterialMutationN23 mutated to P23, L28 mutated to F28, G51 mutat…PromoterT7Available sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRD404
Plasmid#163109PurposeExpression of mNeonGreen_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmNeonGreen_H-NSdbd
UseTagsExpressionBacterialMutationPromoteraraBAD promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET22b-ecDHFR-N23PP/G51PEKN
Plasmid#118583PurposeBacterial expression of E.coli DHFR N23PP and G51PEKN mutantDepositorInsertDHFR
UseTagsExpressionBacterialMutationN23 mutated to P23, G51 mutated to P51, a Pro res…PromoterT7Available sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZS1[FruR-T]
Plasmid#60752PurposeContains PIq driving expression FruR-T, the Fructose inducible chimera with the TAN DBD.DepositorInsertsFruR-T
FruR-T
UseSynthetic BiologyTagsExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…PromoterAvailable sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
T7 Lig-C-HiBiT
Plasmid#215441PurposeBacterially expressed T7 Lig-C-HiBit for Ni-NTA purificationDepositorInsertEscherichia phage T7 DNA Ligase, C-terminal HiBiT, C-terminal 10XHis.Thrombin tag
UseTags10xHis-tag with thrombin site and HiBiT TagExpressionBacterialMutationCodon Optimized for bacterial expression, T7 gene…PromoterT7 PromotorAvailable sinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7 Lig-N-HiBiT
Plasmid#215479PurposeBacterially expressed T7 Lig-N-HiBiT for Ni-NTA purificationDepositorInsertEscherichia phage T7 DNA Ligase, N-terminal HiBiT, N-terminal 10XHis.Thrombin tag
UseTags10xHis-tag with thrombin site and HiBiT tagExpressionBacterialMutationCodon Optimized for bacterial expression, T7 gene…PromoterT7Available sinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB1163
Plasmid#210032PurposeContains Cas3 gRNA cloning site, inducible Cas11-P2A-Cas6-T2A-Cas3, rtTA-T2A-blastDepositorInsertsCas11-P2A-Cas6-T2A-Cas3
rtta-T2A-blast
UseCRISPRTagsSV40 NLSExpressionMammalianMutationPromoterEF-1α and TRE3GAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB758
Plasmid#210033PurposeContains inducible Cas7-P2A-Cas5-T2A-Cas8, rtTA-T2A-puroDepositorInsertsCas7-P2A-Cas5-T2A-Cas8
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianMutationPromoterEF-1α and TRE3GAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
UseTagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…PromoterAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
UseTagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…PromoterAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC25A46[∆2-83]-His (SB258)
Plasmid#227607PurposeInducible expression of His-tagged SLC25A46 lacking its N-terminal region (∆2-83) in Pichia pastorisDepositorInsertSLC25A46 (SLC25A46 Human)
UseTags10xHisExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC25A46[I349D]-His (SB256)
Plasmid#227605PurposeInducible expression of His-tagged SLC25A46 with I349D mutation in Pichia pastorisDepositorInsertSLC25A46 (SLC25A46 Human)
UseTags10xHisExpressionYeastMutationI349DPromoterAOX1Available sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC3.1_CMV_oROS-G_LF(C199S)
Plasmid#216112PurposeExpresses the loss-of-function mutations C199S of the genetically encoded green fluorescent hydrogen peroxide sensor oROS-G in mamalian cells.DepositorInsertoROS-G_LF(C199S)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-mini v2-HF24_F4
Plasmid#195718PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#4 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 20, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F20
Plasmid#195734PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#20 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F5
Plasmid#195719PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#5 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F12
Plasmid#195726PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#12 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F3
Plasmid#195717PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#3 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F24
Plasmid#195738PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#24 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits