We narrowed to 10,627 results for: otos
-
Plasmid#44573DepositorUseRetroviralTagsMycExpressionMammalianMutationTRF2 where TRFH domain (aa42-241) has been replac…Available SinceMay 16, 2013AvailabilityAcademic Institutions and Nonprofits only
-
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Myc-TRFcM
Plasmid#44575DepositorUseRetroviralTagsMycExpressionMammalianMutationTRF2 DNA-binding domain (aa 444-500) is replaced …Available SinceMay 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP (TD)
Plasmid#61529PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIP (with TD mutation)DepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TD mutation (see comments) and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
mChF-AIP (TE)
Plasmid#61530PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIP (with TE mutation)DepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TE mutation (see comments) and mCherryExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat DJ-1 shRNA
Plasmid#222870PurposeExpresses mTagBFP2 along with an shRNA against rat DJ-1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-CD52-bglpA
Plasmid#89704PurposeHuman CD52 expression plasmid with short polyADepositorAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
YF-AIP
Plasmid#61525PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with EYFP and AIPDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
CF-AIP
Plasmid#61526PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with ECFP and AIPDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-scramble shRNA - mCherry
Plasmid#245064PurposeAAV transgene designes to express scramble (control) shRNA sequence cell-type selectively. Scramble hairpin expressed from the mir30 cassette together with mCherry.DepositorInsertAAV-DIO-scramble-shRNA-mCherry
UseAAV, Cre/Lox, and RNAiTagsmCherryExpressionMammalianPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Strep-KIFC1*-mCh
Plasmid#120169PurposeExpresses a chimera of streptavidin, a KIFC1-based retrograde motor and mCherry (fluorescent tag)DepositorInsertkinesin family member C1 (KIFC1 Human)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIFC1: 125-673 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF5B*-strep
Plasmid#120164PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF5B-based anterograde motor and streptavidinDepositorInsertkinesin family member 5B (Kif5b Mouse)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF5B: 1-555 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro
Plasmid#89991PurposeDonor template for generation of SOX2-ntdTomato reporter cell linesDepositorAvailable SinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCh-KIF1A*-strep
Plasmid#120165PurposeExpresses a chimera of mCherry (fluorescent tag), a KIF1A-based anterograde motor and streptavidinDepositorInsertkinesin family member 1A (Kif1a Mouse)
TagsStreptavidin and mCherryExpressionMammalianMutationTruncated KIF1A: 1-405 aaPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Mm2
Plasmid#197100PurposeTo express the variant of Methanosarcina mazei PylRS specific for pyrrolysine derivatives (Boc-Lys, Az-ZLys, AzAmZLys) and its cognate Pyl tRNA and allow UAG codon to be translated into these derivatiDepositorInsertPylRS variant, Pyl tRNA, kanamycin resistance gene
ExpressionBacterialMutationLys61, Glu131, Ala306, Phe384, Glu444 (PylRS)Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
opto-E-cad GFP
Plasmid#203327PurposeExpresses E-cadherin with a LOV2 insert after T133 for blue light inhibition in mammalian cellsDepositorInsertPhotoswitchable - E-cadherin with GFP tag (CDH1 Human)
TagsGFPExpressionMammalianMutationAddition of Aslov2 domain at T133 of human E-cadh…Available SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe-TetCMV-puro-mCherry-PA-Rac1
Plasmid#22035PurposeExpression of photoactivatable Rac1DepositorInsertmCherry-PA-Rac1 (RAC1 Human, Avena sativa (oat))
UseRetroviralExpressionMammalianMutationRac1 starts at I4 and contains mutations Q61L, E9…PromoterTet-CMVAvailable SinceSept. 11, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(wt)
Plasmid#107614PurposeN-terminal half of π-EB1 with wild-type LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain and GCN4 leuc…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-PA-Rac1-T17N
Plasmid#22029PurposeExpression of photoactivatable Rac1 (dominant-negative mutant).DepositorInsertPA-Rac1-T17N (RAC1 Human, Avena sativa (oat))
Tags6xHis and mCherryExpressionBacterial, Insect, and Mamm…MutationLOV(Leu404-Leu546). Rac1 starts at Ile4 and conta…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only