We narrowed to 8,172 results for: AAV
-
Plasmid#214016PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-TNNT2-Zeo
Plasmid#214017PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP301-pAAV-CMV-MCS3-pA
Plasmid#113676PurposeCMV driven Multi Cloning Site-3DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeQ-GFP
Plasmid#123317PurposeAAV-mediated expression of ChromeQ-GFP under the Syn promoter.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable SinceMarch 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-K-red-SPOTIT
Plasmid#191490PurposeRed fluorescent-based opioid sensor for the kappa opioid receptor in AAV viral vector under a CAG promoterDepositorInsertK-red-SPOTIT
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-M-red-SPOTIT2
Plasmid#191491PurposeRed fluorescent-based opioid sensor for the mu opioid receptor in AAV viral vector under a CAG promoterDepositorInsertM-red-SPOTIT2
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_CCK1.0
Plasmid#208674PurposeExpresses the genetically-encoded fluorescent cholecystokinin (CCK) sensor GRAB_CCK1.0 in a cre-dependent mannerDepositorInsertGPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-GFP
Plasmid#197883PurposeCan be used to generate AAV virus that will express GFP in the presence of CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-mRuby3-WPRE
Plasmid#135427PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterEf1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6sgp53-mTSG-GFAPCre
Plasmid#100276PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genesDepositorUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…ExpressionMammalianAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC-S227A
Plasmid#200560PurposeSecreted mouse CES2A S227A mutant driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A S227A mutant delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterCMV promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS2-3xHA
Plasmid#84917PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassetteDepositorInsertLOX-PGK-NEO-LOX
UseAAVTagsPQS2 3xHAPromotermPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOttc1495 - pAAV CaMKII SERCaMP_ASARTDL
Plasmid#192602PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-RAB11
Plasmid#203731PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under the human synapsin (SYN) promoterDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-tdTomato
Plasmid#122099PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only