We narrowed to 18,992 results for: Met
-
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
MlumB10
Plasmid#245863PurposeArchael (Methanomassiliicoccus luminyensis B10) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCB70
Plasmid#245856PurposeArchael (Methanosuratincola verstraetei LCB70) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCB24
Plasmid#245855PurposeArchael (Methanoglobus hypatiae LCB24) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PaPchF-AMT
Plasmid#242104PurposeAdenylase-methyltransferase didomain of the nonribosomal peptide synthetase Pchf from Pseudomonas aeruginosa for the production of pyochelinDepositorInsertPaPchF-AMT
Tags6xHisExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1553
Plasmid#238470PurposepMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1554
Plasmid#238471PurposepMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1525
Plasmid#226496PurposepMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1520
Plasmid#221581PurposepMOBK360_VR: Vector Right (VR) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1518
Plasmid#221579PurposepMOBK360_VL: Vector Left (VL) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1519
Plasmid#221580PurposepMOBK360_VM: Vector Middle (VM) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUASTattB-cytoFLARE1.0-TEV
Plasmid#234519PurposeTranscriptional reporter for detecting calcium transients in Drosophila larvae (TEVp)DepositorInsertCaM-V5-TEVp
ExpressionInsectAvailable SinceMay 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
T7-LacO-Halo-STReTCh-RGD
Plasmid#216532PurposeExpresses HaloTag-STReTCh-RGD fusion protein in bacteriaDepositorInsertHaloTag-STReTCh-RGD
Tags6xHis and HaloTagExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEB2-2ndVal DsRedEx2
Plasmid#104024PurposePlasmid encoding 2ndVal DsRed-Express2DepositorInsert2ndVal DsRed-Express2
UseLow copyExpressionBacterialMutationDsRed-Express2 with valine inserted in 2nd positiā¦PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP757-1
Plasmid#99493Purpose6XHis::TEV::3XFlag::linker::MycDepositorInsert6XHis::TEV::3XFlag::linker::Myc
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP605-1
Plasmid#99482PurposeMyc::TEV::3XFlag::TEV::MycDepositorInsertMyc::TEV::3XFlag::TEV::Myc
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP640-2
Plasmid#99487Purpose3XFlag::TEV::V5::mOrange2::V5::TEV::3XFlagDepositorInsert3XFlag::TEV::V5::mOrange2::V5::TEV::3XFlag
ExpressionBacterialAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSM2
Plasmid#85753PurposepDONR split marker vector (GenBank accession number: KX904529) for fungal gene deletion. Used with pSM1.DepositorTypeEmpty backboneExpressionBacterialPromoterN/AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSM1
Plasmid#85752PurposepDONR split marker vector (GenBank accession number: KX904528) for fungal gene deletion. Used with pSM2.DepositorTypeEmpty backboneExpressionBacterialPromoterN/AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pattB-synaptobrevin-13-QFBDAD-G4MD257-761-hsp70
Plasmid#46122DepositorInsertQFBDAD-G4MD257-761
ExpressionInsectAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only