We narrowed to 14,352 results for: Cas9
-
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS640
Plasmid#188892PurposettTi5605 MosSci targeting vector with Pmex-5::Cas9 and floxed Cbr-unc-119 markerDepositorInsertPmex-5::Cas9, Cbr-unc-119
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSPromoterCytomegalo Virus(CMV)Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DDR_MKOv4
Pooled library#140219PurposeKnockout library targeting human DNA damage response and DNA repair genes.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SunTagng22aa
Plasmid#106438PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genome.DepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
YL-CashGem-BAT1-URA3-LINEAR
Plasmid#174837PurposepRS414 backbone containing LINEAR fragment targeting BAT1 in Y. lipolyticaDepositorInsertCodon optimized Cas9:hGem
UseCRISPR and Synthetic BiologyTagshGeminin tagExpressionBacterial and YeastPromoterGPDpAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK33/intein-Cas9_S219-3XFLAG
Plasmid#133782PurposeExpresses human codon-optimized intein-Cas9DepositorInsertHuman codon-optimized intein-Cas9
ExpressionInsectAvailable sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL469
Plasmid#126458PurposeExpresses Cas9-15xFlag-TdT in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsExpressionMammalianPromoterCMVAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair4
Plasmid#98975PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 94bp 3' overhangs. TagBFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA sgRNAs pair 4 and Cas9(D10A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available sinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-RSV-SpCas9 (AAV8)
Viral prep#85450-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-RSV-SpCas9 (#85450). In addition to the viral particles, you will also receive purified pAAV-RSV-SpCas9 plasmid DNA. RSV-driven expression of SpCas9. These AAV preparations are suitable purity for injection into animals.DepositorPromoterpRSVAvailable sinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9C-P2A-turboGFP
Plasmid#80935PurposePlasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9C
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
KM-CashGem-Xyl2-URA3-LINEAR
Plasmid#174838PurposepRS414 backbone containing LINEAR fragment targeting XYL2 in K. marxianusDepositorInsertCodon optimized Cas9:hGem
UseCRISPR and Synthetic BiologyTagshGeminin tagExpressionBacterial and YeastPromoterTEF1pAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
Tagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only